Schema for Simple Repeats - Simple Tandem Repeats by TRF
  Database: hg38    Primary Table: simpleRepeat    Row Count: 1,031,708   Data last updated: 2018-08-10
Format description: Describes the Simple Tandem Repeats
fieldexampleSQL type description
bin 585smallint(5) unsigned Indexing field to speed chromosome range queries.
chrom chr1varchar(255) Reference sequence chromosome or scaffold
chromStart 10000int(10) unsigned Start position in chromosome
chromEnd 10468int(10) unsigned End position in chromosome
name trfvarchar(255) Simple Repeats tag name
period 6int(10) unsigned Length of repeat unit
copyNum 77.2float Mean number of copies of repeat
consensusSize 6int(10) unsigned Length of consensus sequence
perMatch 95int(10) unsigned Percentage Match
perIndel 3int(10) unsigned Percentage Indel
score 789int(10) unsigned Alignment Score = 2*match-7*mismatch-7*indel; minscore=50
A 33int(10) unsigned Percent of A's in repeat unit
C 51int(10) unsigned Percent of C's in repeat unit
G 0int(10) unsigned Percent of G's in repeat unit
T 15int(10) unsigned Percent of T's in repeat unit
entropy 1.43float Entropy
sequence TAACCClongblob Sequence of repeat unit element

Sample Rows
 
binchromchromStartchromEndnameperiodcopyNumconsensusSizeperMatchperIndelscoreACGTentropysequence
585chr11000010468trf677.2695378933510151.43TAACCC
585chr11062710800trf29629100034613384701.43AGGCGCGCCGCGCCGGCGCAGGCGCAGAG
585chr11075710997trf763.27695243417304561.73GGCGCAGGCGCAGAGAGGCGCGCCGCGCCGGCGCAGGCGCAGAGACACATGCTAGCGCGTCCAGGGGTGGAGGCGT
585chr11122511447trf1171.91218014273123233201.9CGCCCCCTGCTGGCGACTAGGGCAACTGCAGGGTCCTCTTGCTCAAGGTGAGTGGCAGACGCCCACCTGCTGGCAGCCGGGGACACTGCAGGGCCCTCTTGCTTACTGTATAGTGGTGGCA
585chr11127111448trf612.961824187123234201.9AGTGGTGGCACGCCACCTGCTGGCAGCTAGGGACACTGCAGGGCCCTCTTGCTCAAGGTAT
585chr11128311448trf622.761822199123333201.9CGCCCCCTGCTGGCAGCTGGGGACACTGCAGGGCCCTCTTGCTCAAGGTATAGTGGCAGCA
585chr11930519443trf7027094224222755141.65TGAGAAGGCAGAGGCGCGACTGGGGTTCATGAGGAAAGGGAGGAGGAGGATGTGGGATGGTGGAGGGGTT
585chr12082820863trf181.91810007051311701.45CACCACAGAAAACAGAGC
585chr13086230959trf247.52758795421511.31TC
585chr14483544876trf4104945737300260.84AAAT

Note: all start coordinates in our database are 0-based, not 1-based. See explanation here.

Simple Repeats (simpleRepeat) Track Description
 

Description

This track displays simple tandem repeats (possibly imperfect repeats) located by Tandem Repeats Finder (TRF) which is specialized for this purpose. These repeats can occur within coding regions of genes and may be quite polymorphic. Repeat expansions are sometimes associated with specific diseases.

Methods

For more information about the TRF program, see Benson (1999).

Credits

TRF was written by Gary Benson.

References

Benson G. Tandem repeats finder: a program to analyze DNA sequences. Nucleic Acids Res. 1999 Jan 15;27(2):573-80. PMID: 9862982; PMC: PMC148217