Schema for Simple Repeats - Simple Tandem Repeats by TRF
  Database: mm10    Primary Table: simpleRepeat    Row Count: 1,687,263   Data last updated: 2021-04-08
Format description: Describes the Simple Tandem Repeats
fieldexampleSQL type description
bin 607smallint(5) unsigned Indexing field to speed chromosome range queries.
chrom chr1varchar(255) Reference sequence chromosome or scaffold
chromStart 3000097int(10) unsigned Start position in chromosome
chromEnd 3000123int(10) unsigned End position in chromosome
name trfvarchar(255) Simple Repeats tag name
period 1int(10) unsigned Length of repeat unit
copyNum 26float Mean number of copies of repeat
consensusSize 1int(10) unsigned Length of consensus sequence
perMatch 100int(10) unsigned Percentage Match
perIndel 0int(10) unsigned Percentage Indel
score 52int(10) unsigned Alignment Score = 2*match-7*mismatch-7*indel; minscore=50
A 0int(10) unsigned Percent of A's in repeat unit
C 0int(10) unsigned Percent of C's in repeat unit
G 0int(10) unsigned Percent of G's in repeat unit
T 100int(10) unsigned Percent of T's in repeat unit
entropy 0float Entropy
sequence Tlongblob Sequence of repeat unit element

Sample Rows
 
binchromchromStartchromEndnameperiodcopyNumconsensusSizeperMatchperIndelscoreACGTentropysequence
607chr130000973000123trf12611000520001000T
607chr130031643003639trf2222.1221825564182925261.98ACAAGATGGCTCCCTCACCTGCTCTGGGGTCAGACCCTCCCAGATGACCACCTCTCCTATGGCGGGGAAGGTACCTGGAAGTCTAAAGCCCAAAACAGGGACCTATCCCAGAAGCTGTGTAGCTTCTG ...
607chr130034853003546trf272.32783881133221321.91GCCTGTCCCAGAAGCTGTATTGCTTCT
607chr130042063004270trf416.54806787523100.9ACAA
607chr130042083004270trf272.327885907522100.88AAACAAACAACAAAAAAACAAACAAAA
607chr130067893006841trf114.8108217688401500.62GAAAAAAAAA
607chr130067903006839trf68.768410688501400.59AAAAGA
607chr130067903006841trf173.1168910778601300.58AAAAGAAAAAGAAAAA
607chr130093503009407trf22929631070049501TG
607chr130106463010686trf172.317914620020800.72TTTTTGGTTTGTTTGTT

Note: all start coordinates in our database are 0-based, not 1-based. See explanation here.

Simple Repeats (simpleRepeat) Track Description
 

Description

This track displays simple tandem repeats (possibly imperfect repeats) located by Tandem Repeats Finder (TRF) which is specialized for this purpose. These repeats can occur within coding regions of genes and may be quite polymorphic. Repeat expansions are sometimes associated with specific diseases.

Methods

For more information about the TRF program, see Benson (1999).

Credits

TRF was written by Gary Benson.

References

Benson G. Tandem repeats finder: a program to analyze DNA sequences. Nucleic Acids Res. 1999 Jan 15;27(2):573-80. PMID: 9862982; PMC: PMC148217