Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 544 in window, 33031597 - 33031610, 14 bps 
B D                     Human  tactttgcactcca
B D                     Chimp  cactttgcactcca
B D                   Gorilla  cactttgcactcca
B D                 Orangutan  ----ttgcactcca
B D                    Gibbon  ----ttgcactcca
B D                    Rhesus  ----ctgcactcca
B D       Crab-eating macaque  ----ctgcactcca
B D                    Baboon  ----ctgcactcca
B D              Green monkey  ----ctgcactcca
           Chinese tree shrew  --------------
B D                  Squirrel  --------------
B D                       Cow  ----cagagaaatg
B D                     Horse  ---caggagtcaca
               Pacific walrus  --ctctgtgctcca
                 Weddell seal  --ctctgtgctcca
B D                 Armadillo  --------------
B D                  Hedgehog  ==============
              Golden hamster  ==============
B D                      Pika  ==============
             Star-nosed mole  ==============
B D                     Shrew  ==============
B D                    Rabbit  --------------
B D                    Tenrec  ==============
                Prairie vole  ==============
B D           Chinese hamster  ==============
B D                       Rat  ==============
B D            Naked mole-rat  ==============
         Cape elephant shrew  ==============
                  Chinchilla  --------------
B D                     Mouse  ==============
            Brush-tailed rat  ==============
      Lesser Egyptian jerboa  ==============
B D                Guinea pig  ==============
         Pundamilia nyererei  ==============
B D                    Lizard  ==============
B D              Nile tilapia  ==============
       Burton's mouthbreeder  ==============
B D               Stickleback  ==============
          Southern platyfish  ==============
B D                 Tetraodon  ==============
B D                   Dolphin  ==============
B D                       Pig  ==============
                    Aardvark  ==============
B D                   Wallaby  ==============
    Mexican tetra (cavefish)  ==============
                 Spotted gar  ==============
      Yellowbelly pufferfish  ==============
B D                      Fugu  ==============
B D                Coelacanth  ==============
B D                    Medaka  ==============
B D             X. tropicalis  ==============
  D           Green seaturtle  ==============
  D  Chinese softshell turtle  ==============
  D              Mallard duck  ==============
  D    Spiny softshell turtle  --------------
  D            Painted turtle  --------------
            Cape golden mole  ==============
  D             Scarlet macaw  ==============
B D                Budgerigar  ==============
  D          Peregrine falcon  --------------
  D              Saker falcon  --------------
          Tibetan ground jay  ==============
  D               Rock pigeon  ==============
  D       Collared flycatcher  ==============
B D           Tasmanian devil  ==============
B D                   Opossum  ==============
                Killer whale  --------------
              Bactrian camel  ==============
B D              Atlantic cod  --------------
B D                    Turkey  --------------
B D                   Manatee  ==============
               Big brown bat  ==============
B D                   Chicken  ==============
B D       Medium ground finch  ==============
B D                  Platypus  ==============
B D                     Sheep  ==============
            Tibetan antelope  ==============
B D                  Elephant  ==============
            Black flying-fox  ==============
        David's myotis (bat)  ==============
B D                       Dog  ==============
               Domestic goat  ==============
B D        American alligator  ==============
B D               Zebra finch  ==============
B D                    Alpaca  ==============
B D                     Panda  ==============
B D                   Ferret   ==============
B D                       Cat  ==============
B D          White rhinoceros  --------------
B D                  Bushbaby  --------------
B D           Squirrel monkey  --------------
B D                  Marmoset  --------------

Inserts between block 1 and 2 in window
B D                      Cow 2bp

Alignment block 2 of 544 in window, 33031611 - 33031660, 50 bps 
B D                     Human  gcctgagcaacaagagtgagactctga------ctaaaaaaaaagagaaaaaat----------------
B D                     Chimp  gcctgagcaacaagagtgagactctga------cttaaaaaaa-gaggaaaaa-----------------
B D                   Gorilla  gcctgagcaacaagagtgagactctga------ctaaaaaaaaagagaaaaaa-----------------
B D                 Orangutan  gcctgagcaacaagagtgaaactctgt------caaaaaaaaaaaaaaagaaagaaagaaagaaagaaaa
B D                    Gibbon  gcctgagcaacaagagtgaaactctgt------ctaaaaa------------------------------
B D                    Rhesus  gcctgggcaacaagaatgaaactctgt------caaaaaagaaagaaagaaag-----------------
B D       Crab-eating macaque  gcctgggcaacaagaatgaaactctgt------caaaaaagaaagaaagaaag-----------------
B D                    Baboon  gcctgggcaacaagaatgaaactctgt------taaaa-------aaaaaaaa-----------------
B D              Green monkey  gcctgggcaacaagaatgaaactctgt------caaaaaaaagaaaaaaaaaa-----------------
B D                  Squirrel  -------------------------gt------catagaaaaagga------------------------
                 Killer whale  -----------------------ctggattctg-------------------------------------
B D                       Cow  -----------------gaatccctggtt-----------------------------------------
B D                     Horse  --------gaaaatgatgattccctgg-------------------------------------------
B D          White rhinoceros  ------------ataagaactcggcta-------------------------------------------
B D                  Hedgehog  ======================================================================
              Golden hamster  ======================================================================
B D                      Pika  ======================================================================
             Star-nosed mole  ======================================================================
B D                     Shrew  ======================================================================
B D                    Rabbit  ----------------------------------------------------------------------
B D                    Tenrec  ======================================================================
                Prairie vole  ======================================================================
B D           Chinese hamster  ======================================================================
B D                       Rat  ======================================================================
B D            Naked mole-rat  ======================================================================
B D                 Armadillo  ----------------------------------------------------------------------
         Cape elephant shrew  ======================================================================
                  Chinchilla  ----------------------------------------------------------------------
B D                     Mouse  ======================================================================
            Brush-tailed rat  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                Guinea pig  ======================================================================
         Pundamilia nyererei  ======================================================================
B D                    Lizard  ======================================================================
B D              Nile tilapia  ======================================================================
       Burton's mouthbreeder  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
B D                 Tetraodon  ======================================================================
B D                   Dolphin  ======================================================================
B D                       Pig  ======================================================================
                    Aardvark  ======================================================================
B D                   Wallaby  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
                 Spotted gar  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                Coelacanth  ======================================================================
B D                    Medaka  ======================================================================
B D             X. tropicalis  ======================================================================
                Weddell seal  ----------------------------------------------------------------------
  D           Green seaturtle  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D              Mallard duck  ======================================================================
  D    Spiny softshell turtle  ----------------------------------------------------------------------
  D            Painted turtle  ----------------------------------------------------------------------
            Cape golden mole  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                Budgerigar  ======================================================================
  D          Peregrine falcon  ----------------------------------------------------------------------
  D              Saker falcon  ----------------------------------------------------------------------
          Tibetan ground jay  ======================================================================
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Opossum  ======================================================================
              Bactrian camel  ======================================================================
B D              Atlantic cod  ----------------------------------------------------------------------
B D                    Turkey  ----------------------------------------------------------------------
B D                   Manatee  ======================================================================
               Big brown bat  ======================================================================
B D                   Chicken  ======================================================================
B D       Medium ground finch  ======================================================================
B D                  Platypus  ======================================================================
B D                     Sheep  ======================================================================
            Tibetan antelope  ======================================================================
B D                  Elephant  ======================================================================
            Black flying-fox  ======================================================================
        David's myotis (bat)  ======================================================================
B D                       Dog  ======================================================================
               Domestic goat  ======================================================================
B D        American alligator  ======================================================================
B D               Zebra finch  ======================================================================
B D                    Alpaca  ======================================================================
              Pacific walrus  ----------------------------------------------------------------------
B D                     Panda  ======================================================================
B D                   Ferret   ======================================================================
          Chinese tree shrew  ----------------------------------------------------------------------
B D                       Cat  ======================================================================
B D                  Bushbaby  ----------------------------------------------------------------------
B D           Squirrel monkey  ----------------------------------------------------------------------
B D                  Marmoset  ----------------------------------------------------------------------

                        Human  ----------------------------------------------------------------------
                        Chimp  ----------------------------------------------------------------------
                      Gorilla  ----------------------------------------------------------------------
                    Orangutan  agaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaggaaagaaagaaagaagaaaagaaag
                       Gibbon  ----------------------------------------------------------------------
                       Rhesus  ----------------------------------------------------------------------
          Crab-eating macaque  ----------------------------------------------------------------------
                       Baboon  ----------------------------------------------------------------------
                 Green monkey  ----------------------------------------------------------------------
                     Squirrel  ----------------------------------------------------------------------
                 Killer whale  ----------------------------------------------------------------------
                          Cow  ----------------------------------------------------------------------
                        Horse  ----------------------------------------------------------------------
             White rhinoceros  ----------------------------------------------------------------------
                     Hedgehog  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
              Star-nosed mole  ======================================================================
                        Shrew  ======================================================================
                       Rabbit  ----------------------------------------------------------------------
                       Tenrec  ======================================================================
                 Prairie vole  ======================================================================
              Chinese hamster  ======================================================================
                          Rat  ======================================================================
               Naked mole-rat  ======================================================================
                    Armadillo  ----------------------------------------------------------------------
          Cape elephant shrew  ======================================================================
                   Chinchilla  ----------------------------------------------------------------------
                        Mouse  ======================================================================
             Brush-tailed rat  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                   Guinea pig  ======================================================================
          Pundamilia nyererei  ======================================================================
                       Lizard  ======================================================================
                 Nile tilapia  ======================================================================
        Burton's mouthbreeder  ======================================================================
                  Stickleback  ======================================================================
           Southern platyfish  ======================================================================
                    Tetraodon  ======================================================================
                      Dolphin  ======================================================================
                          Pig  ======================================================================
                     Aardvark  ======================================================================
                      Wallaby  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                  Spotted gar  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                   Coelacanth  ======================================================================
                       Medaka  ======================================================================
                X. tropicalis  ======================================================================
                 Weddell seal  ----------------------------------------------------------------------
              Green seaturtle  ======================================================================
     Chinese softshell turtle  ======================================================================
                 Mallard duck  ======================================================================
       Spiny softshell turtle  ----------------------------------------------------------------------
               Painted turtle  ----------------------------------------------------------------------
             Cape golden mole  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
             Peregrine falcon  ----------------------------------------------------------------------
                 Saker falcon  ----------------------------------------------------------------------
           Tibetan ground jay  ======================================================================
                  Rock pigeon  ======================================================================
          Collared flycatcher  ======================================================================
              Tasmanian devil  ======================================================================
                      Opossum  ======================================================================
               Bactrian camel  ======================================================================
                 Atlantic cod  ----------------------------------------------------------------------
                       Turkey  ----------------------------------------------------------------------
                      Manatee  ======================================================================
                Big brown bat  ======================================================================
                      Chicken  ======================================================================
          Medium ground finch  ======================================================================
                     Platypus  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Elephant  ======================================================================
             Black flying-fox  ======================================================================
         David's myotis (bat)  ======================================================================
                          Dog  ======================================================================
                Domestic goat  ======================================================================
           American alligator  ======================================================================
                  Zebra finch  ======================================================================
                       Alpaca  ======================================================================
               Pacific walrus  ----------------------------------------------------------------------
                        Panda  ======================================================================
                      Ferret   ======================================================================
           Chinese tree shrew  ----------------------------------------------------------------------
                          Cat  ======================================================================
                     Bushbaby  ----------------------------------------------------------------------
              Squirrel monkey  ----------------------------------------------------------------------
                     Marmoset  ----------------------------------------------------------------------

                        Human  ---------aa
                        Chimp  -----------
                      Gorilla  -----------
                    Orangutan  aaagaaagaaa
                       Gibbon  -----------
                       Rhesus  aaagaacgaac
          Crab-eating macaque  aaagaacgaac
                       Baboon  aaagaaagaaa
                 Green monkey  aaaaaaagaaa
                     Squirrel  -----------
                 Killer whale  -----------
                          Cow  -----------
                        Horse  -----------
             White rhinoceros  -----------
                     Hedgehog  ===========
               Golden hamster  ===========
                         Pika  ===========
              Star-nosed mole  ===========
                        Shrew  ===========
                       Rabbit  -----------
                       Tenrec  ===========
                 Prairie vole  ===========
              Chinese hamster  ===========
                          Rat  ===========
               Naked mole-rat  ===========
                    Armadillo  -----------
          Cape elephant shrew  ===========
                   Chinchilla  -----------
                        Mouse  ===========
             Brush-tailed rat  ===========
       Lesser Egyptian jerboa  ===========
                   Guinea pig  ===========
          Pundamilia nyererei  ===========
                       Lizard  ===========
                 Nile tilapia  ===========
        Burton's mouthbreeder  ===========
                  Stickleback  ===========
           Southern platyfish  ===========
                    Tetraodon  ===========
                      Dolphin  ===========
                          Pig  ===========
                     Aardvark  ===========
                      Wallaby  ===========
     Mexican tetra (cavefish)  ===========
                  Spotted gar  ===========
       Yellowbelly pufferfish  ===========
                         Fugu  ===========
                   Coelacanth  ===========
                       Medaka  ===========
                X. tropicalis  ===========
                 Weddell seal  -----------
              Green seaturtle  ===========
     Chinese softshell turtle  ===========
                 Mallard duck  ===========
       Spiny softshell turtle  -----------
               Painted turtle  -----------
             Cape golden mole  ===========
                Scarlet macaw  ===========
                   Budgerigar  ===========
             Peregrine falcon  -----------
                 Saker falcon  -----------
           Tibetan ground jay  ===========
                  Rock pigeon  ===========
          Collared flycatcher  ===========
              Tasmanian devil  ===========
                      Opossum  ===========
               Bactrian camel  ===========
                 Atlantic cod  -----------
                       Turkey  -----------
                      Manatee  ===========
                Big brown bat  ===========
                      Chicken  ===========
          Medium ground finch  ===========
                     Platypus  ===========
                        Sheep  ===========
             Tibetan antelope  ===========
                     Elephant  ===========
             Black flying-fox  ===========
         David's myotis (bat)  ===========
                          Dog  ===========
                Domestic goat  ===========
           American alligator  ===========
                  Zebra finch  ===========
                       Alpaca  ===========
               Pacific walrus  -----------
                        Panda  ===========
                      Ferret   ===========
           Chinese tree shrew  -----------
                          Cat  ===========
                     Bushbaby  -----------
              Squirrel monkey  -----------
                     Marmoset  -----------

Inserts between block 2 and 3 in window
B D                 Squirrel 1bp
B D                      Cow 5bp

Alignment block 3 of 544 in window, 33031661 - 33031661, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  g
B D                    Gibbon  a
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
                Domestic goat  g
B D                     Horse  a
B D          White rhinoceros  a
B D                  Hedgehog  =
              Golden hamster  =
B D                      Pika  =
             Star-nosed mole  =
B D                     Shrew  =
B D                    Rabbit  -
B D                    Tenrec  =
                Prairie vole  =
B D           Chinese hamster  =
B D                       Rat  =
B D            Naked mole-rat  =
B D                 Armadillo  -
         Cape elephant shrew  =
                  Chinchilla  -
B D                     Mouse  =
            Brush-tailed rat  =
      Lesser Egyptian jerboa  =
B D                Guinea pig  =
         Pundamilia nyererei  =
B D                    Lizard  =
B D              Nile tilapia  =
       Burton's mouthbreeder  =
B D               Stickleback  =
          Southern platyfish  =
B D                 Tetraodon  =
B D                   Dolphin  =
B D                       Pig  =
                    Aardvark  =
B D                   Wallaby  =
    Mexican tetra (cavefish)  =
                 Spotted gar  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D                Coelacanth  =
B D                    Medaka  =
B D             X. tropicalis  =
                Weddell seal  -
  D           Green seaturtle  =
  D  Chinese softshell turtle  =
  D              Mallard duck  =
  D    Spiny softshell turtle  -
  D            Painted turtle  -
            Cape golden mole  =
  D             Scarlet macaw  =
B D                Budgerigar  =
  D          Peregrine falcon  -
  D              Saker falcon  -
          Tibetan ground jay  =
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D           Tasmanian devil  =
B D                   Opossum  =
                Killer whale  -
              Bactrian camel  =
B D              Atlantic cod  -
B D                    Turkey  -
B D                   Manatee  =
               Big brown bat  =
B D                   Chicken  =
B D       Medium ground finch  =
B D                  Platypus  =
B D                     Sheep  =
B D                       Cow  =
            Tibetan antelope  =
B D                  Elephant  =
            Black flying-fox  =
B D                  Squirrel  =
        David's myotis (bat)  =
B D                       Dog  =
B D        American alligator  =
B D               Zebra finch  =
B D                    Alpaca  =
              Pacific walrus  -
B D                     Panda  =
B D                   Ferret   =
          Chinese tree shrew  -
B D                       Cat  =
B D                  Bushbaby  -
B D           Squirrel monkey  -
B D                  Marmoset  -

Alignment block 4 of 544 in window, 33031662 - 33031663, 2 bps 
B D                     Human  aa
B D                     Chimp  aa
B D                   Gorilla  aa
B D                 Orangutan  aa
B D                    Gibbon  aa
B D                    Rhesus  aa
B D       Crab-eating macaque  aa
B D                    Baboon  aa
B D              Green monkey  aa
                Domestic goat  ga
B D                     Horse  -t
B D          White rhinoceros  -t
B D                       Cat  aa
B D                  Hedgehog  ==
              Golden hamster  ==
B D                      Pika  ==
             Star-nosed mole  ==
B D                     Shrew  ==
B D                    Rabbit  --
B D                    Tenrec  ==
                Prairie vole  ==
B D           Chinese hamster  ==
B D                       Rat  ==
B D            Naked mole-rat  ==
B D                 Armadillo  --
         Cape elephant shrew  ==
                  Chinchilla  --
B D                     Mouse  ==
            Brush-tailed rat  ==
      Lesser Egyptian jerboa  ==
B D                Guinea pig  ==
         Pundamilia nyererei  ==
B D                    Lizard  ==
B D              Nile tilapia  ==
       Burton's mouthbreeder  ==
B D               Stickleback  ==
          Southern platyfish  ==
B D                 Tetraodon  ==
B D                   Dolphin  ==
B D                       Pig  ==
                    Aardvark  ==
B D                   Wallaby  ==
    Mexican tetra (cavefish)  ==
                 Spotted gar  ==
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
B D                Coelacanth  ==
B D                    Medaka  ==
B D             X. tropicalis  ==
                Weddell seal  --
  D           Green seaturtle  ==
  D  Chinese softshell turtle  ==
  D              Mallard duck  ==
  D    Spiny softshell turtle  --
  D            Painted turtle  --
            Cape golden mole  ==
  D             Scarlet macaw  ==
B D                Budgerigar  ==
  D          Peregrine falcon  --
  D              Saker falcon  --
          Tibetan ground jay  ==
  D               Rock pigeon  ==
  D       Collared flycatcher  ==
B D           Tasmanian devil  ==
B D                   Opossum  ==
                Killer whale  --
              Bactrian camel  ==
B D              Atlantic cod  --
B D                    Turkey  --
B D                   Manatee  ==
               Big brown bat  ==
B D                   Chicken  ==
B D       Medium ground finch  ==
B D                  Platypus  ==
B D                     Sheep  ==
B D                       Cow  ==
            Tibetan antelope  ==
B D                  Elephant  ==
            Black flying-fox  ==
B D                  Squirrel  ==
        David's myotis (bat)  ==
B D                       Dog  ==
B D        American alligator  ==
B D               Zebra finch  ==
B D                    Alpaca  ==
              Pacific walrus  --
B D                     Panda  ==
B D                   Ferret   ==
          Chinese tree shrew  --
B D                  Bushbaby  --
B D           Squirrel monkey  --
B D                  Marmoset  --

Alignment block 5 of 544 in window, 33031664 - 33031670, 7 bps 
B D                     Human  aa--------------------------------gaact---
B D                     Chimp  aa--------------------------------gaact---
B D                   Gorilla  aa--------------------------------gaact---
B D                 Orangutan  ag--------------------------------aaact---
B D                    Gibbon  aa--------------------------------gaact---
B D                    Rhesus  aa--------------------------------gaacc---
B D       Crab-eating macaque  aa--------------------------------gaacc---
B D                    Baboon  aa--------------------------------gaacc---
B D              Green monkey  agaaagaaagaaacaaacaaacaaacaaacaaacaaacc---
                Domestic goat  gg--------------------------------gcact---
B D                     Horse  at--------------------------------ggtgc---
B D          White rhinoceros  gc--------------------------------tatgt---
B D                       Cat  aa--------------------------------ttcct---
B D                    Tenrec  -----------------------------------aagcacc
B D                  Hedgehog  ==========================================
              Golden hamster  ==========================================
B D                      Pika  ==========================================
             Star-nosed mole  ==========================================
B D                     Shrew  ==========================================
B D                    Rabbit  ------------------------------------------
                Prairie vole  ==========================================
B D           Chinese hamster  ==========================================
B D                       Rat  ==========================================
B D            Naked mole-rat  ==========================================
B D                 Armadillo  ------------------------------------------
         Cape elephant shrew  ==========================================
                  Chinchilla  ------------------------------------------
B D                     Mouse  ==========================================
            Brush-tailed rat  ==========================================
      Lesser Egyptian jerboa  ==========================================
B D                Guinea pig  ==========================================
         Pundamilia nyererei  ==========================================
B D                    Lizard  ==========================================
B D              Nile tilapia  ==========================================
       Burton's mouthbreeder  ==========================================
B D               Stickleback  ==========================================
          Southern platyfish  ==========================================
B D                 Tetraodon  ==========================================
B D                   Dolphin  ==========================================
B D                       Pig  ==========================================
                    Aardvark  ==========================================
B D                   Wallaby  ==========================================
    Mexican tetra (cavefish)  ==========================================
                 Spotted gar  ==========================================
      Yellowbelly pufferfish  ==========================================
B D                      Fugu  ==========================================
B D                Coelacanth  ==========================================
B D                    Medaka  ==========================================
B D             X. tropicalis  ==========================================
                Weddell seal  ------------------------------------------
  D           Green seaturtle  ==========================================
  D  Chinese softshell turtle  ==========================================
  D              Mallard duck  ==========================================
  D    Spiny softshell turtle  ------------------------------------------
  D            Painted turtle  ------------------------------------------
            Cape golden mole  ==========================================
  D             Scarlet macaw  ==========================================
B D                Budgerigar  ==========================================
  D          Peregrine falcon  ------------------------------------------
  D              Saker falcon  ------------------------------------------
          Tibetan ground jay  ==========================================
  D               Rock pigeon  ==========================================
  D       Collared flycatcher  ==========================================
B D           Tasmanian devil  ==========================================
B D                   Opossum  ==========================================
                Killer whale  ------------------------------------------
              Bactrian camel  ==========================================
B D              Atlantic cod  ------------------------------------------
B D                    Turkey  ------------------------------------------
B D                   Manatee  ==========================================
               Big brown bat  ==========================================
B D                   Chicken  ==========================================
B D       Medium ground finch  ==========================================
B D                  Platypus  ==========================================
B D                     Sheep  ==========================================
B D                       Cow  ==========================================
            Tibetan antelope  ==========================================
B D                  Elephant  ==========================================
            Black flying-fox  ==========================================
B D                  Squirrel  ==========================================
        David's myotis (bat)  ==========================================
B D                       Dog  ==========================================
B D        American alligator  ==========================================
B D               Zebra finch  ==========================================
B D                    Alpaca  ==========================================
              Pacific walrus  ------------------------------------------
B D                     Panda  ==========================================
B D                   Ferret   ==========================================
          Chinese tree shrew  ------------------------------------------
B D                  Bushbaby  ------------------------------------------
B D           Squirrel monkey  ------------------------------------------
B D                  Marmoset  ------------------------------------------

Alignment block 6 of 544 in window, 33031671 - 33031673, 3 bps 
B D                     Human  tgg
B D                     Chimp  tgg
B D                   Gorilla  tgg
B D                 Orangutan  tgg
B D                    Gibbon  tgg
B D                    Rhesus  tgg
B D       Crab-eating macaque  tgg
B D                    Baboon  tga
B D              Green monkey  tgg
B D                  Marmoset  tgg
B D           Squirrel monkey  tgg
B D                  Bushbaby  agg
                Domestic goat  tgg
B D                     Horse  tgg
B D          White rhinoceros  tgg
B D                       Cat  tgg
B D                    Tenrec  tgg
B D                  Hedgehog  ===
              Golden hamster  ===
B D                      Pika  ===
             Star-nosed mole  ===
B D                     Shrew  ===
B D                    Rabbit  ---
                Prairie vole  ===
B D           Chinese hamster  ===
B D                       Rat  ===
B D            Naked mole-rat  ===
B D                 Armadillo  ---
         Cape elephant shrew  ===
                  Chinchilla  ---
B D                     Mouse  ===
            Brush-tailed rat  ===
      Lesser Egyptian jerboa  ===
B D                Guinea pig  ===
         Pundamilia nyererei  ===
B D                    Lizard  ===
B D              Nile tilapia  ===
       Burton's mouthbreeder  ===
B D               Stickleback  ===
          Southern platyfish  ===
B D                 Tetraodon  ===
B D                   Dolphin  ===
B D                       Pig  ===
                    Aardvark  ===
B D                   Wallaby  ===
    Mexican tetra (cavefish)  ===
                 Spotted gar  ===
      Yellowbelly pufferfish  ===
B D                      Fugu  ===
B D                Coelacanth  ===
B D                    Medaka  ===
B D             X. tropicalis  ===
                Weddell seal  ---
  D           Green seaturtle  ===
  D  Chinese softshell turtle  ===
  D              Mallard duck  ===
  D    Spiny softshell turtle  ---
  D            Painted turtle  ---
            Cape golden mole  ===
  D             Scarlet macaw  ===
B D                Budgerigar  ===
  D          Peregrine falcon  ---
  D              Saker falcon  ---
          Tibetan ground jay  ===
  D               Rock pigeon  ===
  D       Collared flycatcher  ===
B D           Tasmanian devil  ===
B D                   Opossum  ===
                Killer whale  ---
              Bactrian camel  ===
B D              Atlantic cod  ---
B D                    Turkey  ---
B D                   Manatee  ===
               Big brown bat  ===
B D                   Chicken  ===
B D       Medium ground finch  ===
B D                  Platypus  ===
B D                     Sheep  ===
B D                       Cow  ===
            Tibetan antelope  ===
B D                  Elephant  ===
            Black flying-fox  ===
B D                  Squirrel  ===
        David's myotis (bat)  ===
B D                       Dog  ===
B D        American alligator  ===
B D               Zebra finch  ===
B D                    Alpaca  ===
              Pacific walrus  ---
B D                     Panda  ===
B D                   Ferret   ===
          Chinese tree shrew  ---

Inserts between block 6 and 7 in window
B D                    Horse 1bp
B D         White rhinoceros 1bp

Alignment block 7 of 544 in window, 33031674 - 33031675, 2 bps 
B D                     Human  ga
B D                     Chimp  ga
B D                   Gorilla  ga
B D                 Orangutan  ga
B D                    Gibbon  ga
B D                    Rhesus  ga
B D       Crab-eating macaque  ga
B D                    Baboon  ga
B D              Green monkey  ga
B D                  Marmoset  ga
B D           Squirrel monkey  ga
B D                  Bushbaby  ga
           Chinese tree shrew  ga
                Domestic goat  ga
B D                     Horse  gg
B D          White rhinoceros  ga
B D                       Cat  gt
B D                     Panda  ga
B D                    Tenrec  ga
B D                 Armadillo  ga
B D                  Hedgehog  ==
              Golden hamster  ==
B D                      Pika  ==
             Star-nosed mole  ==
B D                     Shrew  ==
B D                    Rabbit  --
                Prairie vole  ==
B D           Chinese hamster  ==
B D                       Rat  ==
B D            Naked mole-rat  ==
         Cape elephant shrew  ==
                  Chinchilla  --
B D                     Mouse  ==
            Brush-tailed rat  ==
      Lesser Egyptian jerboa  ==
B D                Guinea pig  ==
         Pundamilia nyererei  ==
B D                    Lizard  ==
B D              Nile tilapia  ==
       Burton's mouthbreeder  ==
B D               Stickleback  ==
          Southern platyfish  ==
B D                 Tetraodon  ==
B D                   Dolphin  ==
B D                       Pig  ==
                    Aardvark  ==
B D                   Wallaby  ==
    Mexican tetra (cavefish)  ==
                 Spotted gar  ==
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
B D                Coelacanth  ==
B D                    Medaka  ==
B D             X. tropicalis  ==
                Weddell seal  --
  D           Green seaturtle  ==
  D  Chinese softshell turtle  ==
  D              Mallard duck  ==
  D    Spiny softshell turtle  --
  D            Painted turtle  --
            Cape golden mole  ==
  D             Scarlet macaw  ==
B D                Budgerigar  ==
  D          Peregrine falcon  --
  D              Saker falcon  --
          Tibetan ground jay  ==
  D               Rock pigeon  ==
  D       Collared flycatcher  ==
B D           Tasmanian devil  ==
B D                   Opossum  ==
                Killer whale  --
              Bactrian camel  ==
B D              Atlantic cod  --
B D                    Turkey  --
B D                   Manatee  ==
               Big brown bat  ==
B D                   Chicken  ==
B D       Medium ground finch  ==
B D                  Platypus  ==
B D                     Sheep  ==
B D                       Cow  ==
            Tibetan antelope  ==
B D                  Elephant  ==
            Black flying-fox  ==
B D                  Squirrel  ==
        David's myotis (bat)  ==
B D                       Dog  ==
B D        American alligator  ==
B D               Zebra finch  ==
B D                    Alpaca  ==
              Pacific walrus  --
B D                   Ferret   ==

Alignment block 8 of 544 in window, 33031676 - 33031678, 3 bps 
B D                     Human  gct
B D                     Chimp  gct
B D                   Gorilla  gct
B D                 Orangutan  gct
B D                    Gibbon  gct
B D                    Rhesus  gct
B D       Crab-eating macaque  gct
B D                    Baboon  gct
B D              Green monkey  gct
B D                  Marmoset  act
B D           Squirrel monkey  gct
B D                  Bushbaby  gct
           Chinese tree shrew  gct
B D                  Squirrel  att
B D                    Rabbit  gct
                Domestic goat  acc
B D                     Horse  act
B D          White rhinoceros  gc-
B D                       Cat  gct
B D                     Panda  gct
B D                    Tenrec  gct
B D                 Armadillo  gcc
B D                  Hedgehog  ===
              Golden hamster  ===
B D                      Pika  ===
             Star-nosed mole  ===
B D                     Shrew  ===
                Prairie vole  ===
B D           Chinese hamster  ===
B D                       Rat  ===
B D            Naked mole-rat  ===
         Cape elephant shrew  ===
                  Chinchilla  ---
B D                     Mouse  ===
            Brush-tailed rat  ===
      Lesser Egyptian jerboa  ===
B D                Guinea pig  ===
         Pundamilia nyererei  ===
B D                    Lizard  ===
B D              Nile tilapia  ===
       Burton's mouthbreeder  ===
B D               Stickleback  ===
          Southern platyfish  ===
B D                 Tetraodon  ===
B D                   Dolphin  ===
B D                       Pig  ===
                    Aardvark  ===
B D                   Wallaby  ===
    Mexican tetra (cavefish)  ===
                 Spotted gar  ===
      Yellowbelly pufferfish  ===
B D                      Fugu  ===
B D                Coelacanth  ===
B D                    Medaka  ===
B D             X. tropicalis  ===
                Weddell seal  ---
  D           Green seaturtle  ===
  D  Chinese softshell turtle  ===
  D              Mallard duck  ===
  D    Spiny softshell turtle  ---
  D            Painted turtle  ---
            Cape golden mole  ===
  D             Scarlet macaw  ===
B D                Budgerigar  ===
  D          Peregrine falcon  ---
  D              Saker falcon  ---
          Tibetan ground jay  ===
  D               Rock pigeon  ===
  D       Collared flycatcher  ===
B D           Tasmanian devil  ===
B D                   Opossum  ===
                Killer whale  ---
              Bactrian camel  ===
B D              Atlantic cod  ---
B D                    Turkey  ---
B D                   Manatee  ===
               Big brown bat  ===
B D                   Chicken  ===
B D       Medium ground finch  ===
B D                  Platypus  ===
B D                     Sheep  ===
B D                       Cow  ===
            Tibetan antelope  ===
B D                  Elephant  ===
            Black flying-fox  ===
        David's myotis (bat)  ===
B D                       Dog  ===
B D        American alligator  ===
B D               Zebra finch  ===
B D                    Alpaca  ===
              Pacific walrus  ---
B D                   Ferret   ===

Inserts between block 8 and 9 in window
               Domestic goat 1bp
B D         White rhinoceros 4bp

Alignment block 9 of 544 in window, 33031679 - 33031680, 2 bps 
B D                     Human  ca
B D                     Chimp  ca
B D                   Gorilla  ca
B D                 Orangutan  ca
B D                    Gibbon  ca
B D                    Rhesus  ca
B D       Crab-eating macaque  ca
B D                    Baboon  aa
B D              Green monkey  ca
B D                  Marmoset  ca
B D           Squirrel monkey  ca
B D                  Bushbaby  ct
           Chinese tree shrew  ct
B D                  Squirrel  c-
B D                    Rabbit  tg
B D                    Tenrec  tg
B D                 Armadillo  cg
B D                  Hedgehog  ==
              Golden hamster  ==
B D                      Pika  ==
             Star-nosed mole  ==
B D                     Shrew  ==
                Prairie vole  ==
B D           Chinese hamster  ==
B D                       Rat  ==
B D            Naked mole-rat  ==
         Cape elephant shrew  ==
                  Chinchilla  --
B D                     Mouse  ==
            Brush-tailed rat  ==
      Lesser Egyptian jerboa  ==
B D                Guinea pig  ==
         Pundamilia nyererei  ==
B D                    Lizard  ==
B D              Nile tilapia  ==
       Burton's mouthbreeder  ==
B D               Stickleback  ==
          Southern platyfish  ==
B D                 Tetraodon  ==
B D                   Dolphin  ==
B D                       Pig  ==
                    Aardvark  ==
B D                   Wallaby  ==
    Mexican tetra (cavefish)  ==
                 Spotted gar  ==
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
B D                Coelacanth  ==
B D                    Medaka  ==
B D             X. tropicalis  ==
                Weddell seal  --
  D           Green seaturtle  ==
  D  Chinese softshell turtle  ==
  D              Mallard duck  ==
  D    Spiny softshell turtle  --
  D            Painted turtle  --
            Cape golden mole  ==
  D             Scarlet macaw  ==
B D                Budgerigar  ==
  D          Peregrine falcon  --
  D              Saker falcon  --
          Tibetan ground jay  ==
  D               Rock pigeon  ==
  D       Collared flycatcher  ==
B D           Tasmanian devil  ==
B D                   Opossum  ==
                Killer whale  --
              Bactrian camel  ==
B D              Atlantic cod  --
B D                    Turkey  --
B D                   Manatee  ==
               Big brown bat  ==
B D                   Chicken  ==
B D       Medium ground finch  ==
B D                  Platypus  ==
B D                     Sheep  ==
B D                       Cow  ==
            Tibetan antelope  ==
B D                  Elephant  ==
            Black flying-fox  ==
        David's myotis (bat)  ==
B D                       Dog  ==
               Domestic goat  ==
B D        American alligator  ==
B D               Zebra finch  ==
B D                    Alpaca  ==
              Pacific walrus  --
B D                     Panda  --
B D                   Ferret   ==
B D                       Cat  --
B D          White rhinoceros  ==
B D                     Horse  --

Alignment block 10 of 544 in window, 33031681 - 33031681, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                  Bushbaby  g
           Chinese tree shrew  g
B D                    Rabbit  g
B D                       Cat  g
B D                   Manatee  g
B D                    Tenrec  g
B D                 Armadillo  a
B D                  Hedgehog  =
              Golden hamster  =
B D                      Pika  =
             Star-nosed mole  =
B D                     Shrew  =
                Prairie vole  =
B D           Chinese hamster  =
B D                       Rat  =
B D            Naked mole-rat  =
         Cape elephant shrew  =
                  Chinchilla  -
B D                     Mouse  =
            Brush-tailed rat  =
      Lesser Egyptian jerboa  =
B D                Guinea pig  =
         Pundamilia nyererei  =
B D                    Lizard  =
B D              Nile tilapia  =
       Burton's mouthbreeder  =
B D               Stickleback  =
          Southern platyfish  =
B D                 Tetraodon  =
B D                   Dolphin  =
B D                       Pig  =
                    Aardvark  =
B D                   Wallaby  =
    Mexican tetra (cavefish)  =
                 Spotted gar  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D                Coelacanth  =
B D                    Medaka  =
B D             X. tropicalis  =
                Weddell seal  -
  D           Green seaturtle  =
  D  Chinese softshell turtle  =
  D              Mallard duck  =
  D    Spiny softshell turtle  -
  D            Painted turtle  -
            Cape golden mole  =
  D             Scarlet macaw  =
B D                Budgerigar  =
  D          Peregrine falcon  -
  D              Saker falcon  -
          Tibetan ground jay  =
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D           Tasmanian devil  =
B D                   Opossum  =
                Killer whale  -
              Bactrian camel  =
B D              Atlantic cod  -
B D                    Turkey  -
               Big brown bat  =
B D                   Chicken  =
B D       Medium ground finch  =
B D                  Platypus  =
B D                     Sheep  =
B D                       Cow  =
            Tibetan antelope  =
B D                  Elephant  =
            Black flying-fox  =
B D                  Squirrel  -
        David's myotis (bat)  =
B D                       Dog  =
               Domestic goat  =
B D        American alligator  =
B D               Zebra finch  =
B D                    Alpaca  =
              Pacific walrus  -
B D                     Panda  -
B D                   Ferret   =
B D          White rhinoceros  =
B D                     Horse  -

Alignment block 11 of 544 in window, 33031682 - 33031682, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
B D                  Bushbaby  t
           Chinese tree shrew  t
B D                    Rabbit  c
B D                   Dolphin  c
             Tibetan antelope  c
B D                       Cow  c
B D                     Sheep  c
                Domestic goat  c
B D                       Cat  c
B D                   Manatee  c
B D                    Tenrec  c
B D                 Armadillo  a
B D                  Hedgehog  =
              Golden hamster  =
B D                      Pika  =
             Star-nosed mole  =
B D                     Shrew  =
                Prairie vole  =
B D           Chinese hamster  =
B D                       Rat  =
B D            Naked mole-rat  =
         Cape elephant shrew  =
                  Chinchilla  -
B D                     Mouse  =
            Brush-tailed rat  =
      Lesser Egyptian jerboa  =
B D                Guinea pig  =
         Pundamilia nyererei  =
B D                    Lizard  =
B D              Nile tilapia  =
       Burton's mouthbreeder  =
B D               Stickleback  =
          Southern platyfish  =
B D                 Tetraodon  =
B D                       Pig  =
                    Aardvark  =
B D                   Wallaby  =
    Mexican tetra (cavefish)  =
                 Spotted gar  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D                Coelacanth  =
B D                    Medaka  =
B D             X. tropicalis  =
                Weddell seal  -
  D           Green seaturtle  =
  D  Chinese softshell turtle  =
  D              Mallard duck  =
  D    Spiny softshell turtle  -
  D            Painted turtle  -
            Cape golden mole  =
  D             Scarlet macaw  =
B D                Budgerigar  =
  D          Peregrine falcon  -
  D              Saker falcon  -
          Tibetan ground jay  =
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D           Tasmanian devil  =
B D                   Opossum  =
                Killer whale  -
              Bactrian camel  =
B D              Atlantic cod  -
B D                    Turkey  -
               Big brown bat  =
B D                   Chicken  =
B D       Medium ground finch  =
B D                  Platypus  =
B D                  Elephant  =
            Black flying-fox  =
B D                  Squirrel  -
        David's myotis (bat)  =
B D                       Dog  =
B D        American alligator  =
B D               Zebra finch  =
B D                    Alpaca  =
              Pacific walrus  -
B D                     Panda  -
B D                   Ferret   =
B D          White rhinoceros  =
B D                     Horse  -

Alignment block 12 of 544 in window, 33031683 - 33031684, 2 bps 
B D                     Human  tg
B D                     Chimp  tg
B D                   Gorilla  tg
B D                 Orangutan  tg
B D                    Gibbon  tg
B D                    Rhesus  tg
B D       Crab-eating macaque  tg
B D                    Baboon  tg
B D              Green monkey  tg
B D                  Marmoset  tg
B D           Squirrel monkey  tg
B D                  Bushbaby  tg
           Chinese tree shrew  ag
B D                    Rabbit  ta
B D                    Alpaca  tg
B D                   Dolphin  tg
             Tibetan antelope  tg
B D                       Cow  tg
B D                     Sheep  tg
                Domestic goat  tg
B D                     Horse  -g
B D                       Cat  tg
B D                     Panda  ca
B D                   Manatee  tg
B D                    Tenrec  tg
B D                 Armadillo  tg
B D                  Hedgehog  ==
              Golden hamster  ==
B D                      Pika  ==
             Star-nosed mole  ==
B D                     Shrew  ==
                Prairie vole  ==
B D           Chinese hamster  ==
B D                       Rat  ==
B D            Naked mole-rat  ==
         Cape elephant shrew  ==
                  Chinchilla  --
B D                     Mouse  ==
            Brush-tailed rat  ==
      Lesser Egyptian jerboa  ==
B D                Guinea pig  ==
         Pundamilia nyererei  ==
B D                    Lizard  ==
B D              Nile tilapia  ==
       Burton's mouthbreeder  ==
B D               Stickleback  ==
          Southern platyfish  ==
B D                 Tetraodon  ==
B D                       Pig  ==
                    Aardvark  ==
B D                   Wallaby  ==
    Mexican tetra (cavefish)  ==
                 Spotted gar  ==
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
B D                Coelacanth  ==
B D                    Medaka  ==
B D             X. tropicalis  ==
                Weddell seal  --
  D           Green seaturtle  ==
  D  Chinese softshell turtle  ==
  D              Mallard duck  ==
  D    Spiny softshell turtle  --
  D            Painted turtle  --
            Cape golden mole  ==
  D             Scarlet macaw  ==
B D                Budgerigar  ==
  D          Peregrine falcon  --
  D              Saker falcon  --
          Tibetan ground jay  ==
  D               Rock pigeon  ==
  D       Collared flycatcher  ==
B D           Tasmanian devil  ==
B D                   Opossum  ==
                Killer whale  --
              Bactrian camel  ==
B D              Atlantic cod  --
B D                    Turkey  --
               Big brown bat  ==
B D                   Chicken  ==
B D       Medium ground finch  ==
B D                  Platypus  ==
B D                  Elephant  ==
            Black flying-fox  ==
B D                  Squirrel  --
        David's myotis (bat)  ==
B D                       Dog  ==
B D        American alligator  ==
B D               Zebra finch  ==
              Pacific walrus  --
B D                   Ferret   ==
B D          White rhinoceros  ==

Inserts between block 12 and 13 in window
B D                   Rabbit 1bp

Alignment block 13 of 544 in window, 33031685 - 33031691, 7 bps 
B D                     Human  accagag
B D                     Chimp  accagag
B D                   Gorilla  accagag
B D                 Orangutan  accagag
B D                    Gibbon  accagag
B D                    Rhesus  accagag
B D       Crab-eating macaque  accagag
B D                    Baboon  accagag
B D              Green monkey  accagag
B D                  Marmoset  accagag
B D           Squirrel monkey  accagag
B D                  Bushbaby  gctggag
           Chinese tree shrew  acaag--
B D                  Squirrel  cctggag
       Lesser Egyptian jerboa  actgaag
B D                    Rabbit  ccagaag
B D                    Alpaca  acttgag
B D                   Dolphin  acttaag
                 Killer whale  ------t
             Tibetan antelope  atttgag
B D                       Cow  tgttggg
B D                     Sheep  atttgag
                Domestic goat  --tgggg
B D                     Horse  gccagag
B D                       Cat  gctgtct
B D                     Panda  gctcgaa
B D                   Manatee  accggag
B D                    Tenrec  cccaaag
B D                 Armadillo  acccgag
B D                  Hedgehog  =======
              Golden hamster  =======
B D                      Pika  =======
             Star-nosed mole  =======
B D                     Shrew  =======
                Prairie vole  =======
B D           Chinese hamster  =======
B D                       Rat  =======
B D            Naked mole-rat  =======
         Cape elephant shrew  =======
                  Chinchilla  -------
B D                     Mouse  =======
            Brush-tailed rat  =======
B D                Guinea pig  =======
         Pundamilia nyererei  =======
B D                    Lizard  =======
B D              Nile tilapia  =======
       Burton's mouthbreeder  =======
B D               Stickleback  =======
          Southern platyfish  =======
B D                 Tetraodon  =======
B D                       Pig  =======
                    Aardvark  =======
B D                   Wallaby  =======
    Mexican tetra (cavefish)  =======
                 Spotted gar  =======
      Yellowbelly pufferfish  =======
B D                      Fugu  =======
B D                Coelacanth  =======
B D                    Medaka  =======
B D             X. tropicalis  =======
                Weddell seal  -------
  D           Green seaturtle  =======
  D  Chinese softshell turtle  =======
  D              Mallard duck  =======
  D    Spiny softshell turtle  -------
  D            Painted turtle  -------
            Cape golden mole  =======
  D             Scarlet macaw  =======
B D                Budgerigar  =======
  D          Peregrine falcon  -------
  D              Saker falcon  -------
          Tibetan ground jay  =======
  D               Rock pigeon  =======
  D       Collared flycatcher  =======
B D           Tasmanian devil  =======
B D                   Opossum  =======
              Bactrian camel  =======
B D              Atlantic cod  -------
B D                    Turkey  -------
               Big brown bat  =======
B D                   Chicken  =======
B D       Medium ground finch  =======
B D                  Platypus  =======
B D                  Elephant  =======
            Black flying-fox  =======
        David's myotis (bat)  =======
B D                       Dog  =======
B D        American alligator  =======
B D               Zebra finch  =======
              Pacific walrus  -------
B D                   Ferret   =======
B D          White rhinoceros  =======

Alignment block 14 of 544 in window, 33031692 - 33031716, 25 bps 
B D                     Human  gt-tgaggg------g-------cca-----gtgggcagaaccc
B D                     Chimp  gt-tgaggg------g-------cca-----gtgggcagaaccc
B D                   Gorilla  gt-tgaggg------g-------cca-----gtgggcagaaccc
B D                 Orangutan  gt-tgaggg------g-------cca-----gtgggcagaaccc
B D                    Gibbon  tt-tgaggg------g-------cca-----gtgggcagaaccc
B D                    Rhesus  gt-tgaggg------g-------cca-----gtgggcagaaccc
B D       Crab-eating macaque  gt-tgaggg------g-------cca-----gtgggcagaaccc
B D                    Baboon  gt-tgaggg------g-------cca-----gtgggcagaaccc
B D              Green monkey  gt-tgaggg------g-------cca-----gtgggcagaaccc
B D                  Marmoset  -c-caaggg------g-------cca-----gtaggcagaaccc
B D           Squirrel monkey  -c-caaggg------g-------cca-----gtaggcagaaccc
B D                  Bushbaby  gt-tgaggg------agtagagccca-----gtgggcagaattt
           Chinese tree shrew  -----------------------c--------------------
B D                  Squirrel  gtattggag------g-------act------------------
       Lesser Egyptian jerboa  gt-tgaggg------g-------aca------------------
B D                    Rabbit  gg-cagggg------c-------agagcccagtgggtctaaccc
B D                    Alpaca  gc-tgagggacaggg-----------------------------
B D                   Dolphin  gt-tgaggggcagtg-----------------------------
                 Killer whale  gt-tggaga-----------------------------------
             Tibetan antelope  gt-tgaggg----tg-----------------------------
B D                       Cow  g--agcaca----tg-----------------------------
B D                     Sheep  gc-tgaggg----tg-----------------------------
                Domestic goat  gc-aggggg----tg-----------------------------
B D          White rhinoceros  cc-cagtgggca--------------------------------
B D                       Cat  gt-ctgggagc---------------------------------
B D                     Panda  gt-taagggaca--------------------------------
B D                   Manatee  gt-ggaggt------ggcagcgccca-----gtgagcagcctcc
B D                    Tenrec  ac-tgaggt------ggcagca-tga-----gtggccagcgtct
B D                 Armadillo  gt-tgaggt------gacagag-------------------tct
B D                  Hedgehog  ============================================
              Golden hamster  ============================================
B D                      Pika  ============================================
             Star-nosed mole  ============================================
B D                     Shrew  ============================================
                Prairie vole  ============================================
B D           Chinese hamster  ============================================
B D                       Rat  ============================================
B D            Naked mole-rat  ============================================
         Cape elephant shrew  ============================================
                  Chinchilla  --------------------------------------------
B D                     Mouse  ============================================
            Brush-tailed rat  ============================================
B D                Guinea pig  ============================================
         Pundamilia nyererei  ============================================
B D                    Lizard  ============================================
B D              Nile tilapia  ============================================
       Burton's mouthbreeder  ============================================
B D               Stickleback  ============================================
          Southern platyfish  ============================================
B D                 Tetraodon  ============================================
B D                       Pig  ============================================
                    Aardvark  ============================================
B D                   Wallaby  ============================================
    Mexican tetra (cavefish)  ============================================
                 Spotted gar  ============================================
      Yellowbelly pufferfish  ============================================
B D                      Fugu  ============================================
B D                Coelacanth  ============================================
B D                    Medaka  ============================================
B D             X. tropicalis  ============================================
                Weddell seal  --------------------------------------------
  D           Green seaturtle  ============================================
  D  Chinese softshell turtle  ============================================
  D              Mallard duck  ============================================
  D    Spiny softshell turtle  --------------------------------------------
  D            Painted turtle  --------------------------------------------
            Cape golden mole  ============================================
  D             Scarlet macaw  ============================================
B D                Budgerigar  ============================================
  D          Peregrine falcon  --------------------------------------------
  D              Saker falcon  --------------------------------------------
          Tibetan ground jay  ============================================
  D               Rock pigeon  ============================================
  D       Collared flycatcher  ============================================
B D           Tasmanian devil  ============================================
B D                   Opossum  ============================================
              Bactrian camel  ============================================
B D              Atlantic cod  --------------------------------------------
B D                    Turkey  --------------------------------------------
               Big brown bat  ============================================
B D                   Chicken  ============================================
B D       Medium ground finch  ============================================
B D                  Platypus  ============================================
B D                  Elephant  ============================================
            Black flying-fox  ============================================
        David's myotis (bat)  ============================================
B D                       Dog  ============================================
B D        American alligator  ============================================
B D               Zebra finch  ============================================
              Pacific walrus  --------------------------------------------
B D                   Ferret   ============================================
B D                     Horse  --------------------------------------------

Inserts between block 14 and 15 in window
B D                 Squirrel 2bp
B D                   Rabbit 2bp

Alignment block 15 of 544 in window, 33031717 - 33031725, 9 bps 
B D                     Human  gagcctcct
B D                     Chimp  gagcctcct
B D                   Gorilla  gagcctcct
B D                 Orangutan  gagcatcct
B D                    Gibbon  gagcctcct
B D                    Rhesus  gagcctcct
B D       Crab-eating macaque  gagcctcct
B D                    Baboon  gagcctcct
B D              Green monkey  gagcctcct
B D                  Marmoset  aagcctcat
B D           Squirrel monkey  aagccttat
B D                  Bushbaby  gaacctcct
           Chinese tree shrew  ---ccttct
       Lesser Egyptian jerboa  gacccttct
             Brush-tailed rat  gggcccagt
B D                    Rabbit  gtgtccttc
B D                    Alpaca  --ccctcct
B D                   Dolphin  ---cctcct
             Tibetan antelope  ---cctcct
B D                     Sheep  ---cctcct
B D          White rhinoceros  gagcctcct
B D                     Panda  gagcctcct
B D                   Manatee  gaccatcct
B D                    Tenrec  gaccatcct
B D                 Armadillo  gagcctcct
B D                  Hedgehog  =========
              Golden hamster  =========
B D                      Pika  =========
             Star-nosed mole  =========
B D                     Shrew  =========
                Prairie vole  =========
B D           Chinese hamster  =========
B D                       Rat  =========
B D            Naked mole-rat  =========
         Cape elephant shrew  =========
                  Chinchilla  ---------
B D                     Mouse  =========
B D                Guinea pig  =========
         Pundamilia nyererei  =========
B D                    Lizard  =========
B D              Nile tilapia  =========
       Burton's mouthbreeder  =========
B D               Stickleback  =========
          Southern platyfish  =========
B D                 Tetraodon  =========
B D                       Pig  =========
                    Aardvark  =========
B D                   Wallaby  =========
    Mexican tetra (cavefish)  =========
                 Spotted gar  =========
      Yellowbelly pufferfish  =========
B D                      Fugu  =========
B D                Coelacanth  =========
B D                    Medaka  =========
B D             X. tropicalis  =========
                Weddell seal  ---------
  D           Green seaturtle  =========
  D  Chinese softshell turtle  =========
  D              Mallard duck  =========
  D    Spiny softshell turtle  ---------
  D            Painted turtle  ---------
            Cape golden mole  =========
  D             Scarlet macaw  =========
B D                Budgerigar  =========
  D          Peregrine falcon  ---------
  D              Saker falcon  ---------
          Tibetan ground jay  =========
  D               Rock pigeon  =========
  D       Collared flycatcher  =========
B D           Tasmanian devil  =========
B D                   Opossum  =========
                Killer whale  ---------
              Bactrian camel  =========
B D              Atlantic cod  ---------
B D                    Turkey  ---------
               Big brown bat  =========
B D                   Chicken  =========
B D       Medium ground finch  =========
B D                  Platypus  =========
B D                       Cow  ---------
B D                  Elephant  =========
            Black flying-fox  =========
B D                  Squirrel  =========
        David's myotis (bat)  =========
B D                       Dog  =========
               Domestic goat  ---------
B D        American alligator  =========
B D               Zebra finch  =========
              Pacific walrus  ---------
B D                   Ferret   =========
B D                       Cat  ---------
B D                     Horse  ---------

Alignment block 16 of 544 in window, 33031726 - 33031730, 5 bps 
B D                     Human  cctct-
B D                     Chimp  cctct-
B D                   Gorilla  cctct-
B D                 Orangutan  cctct-
B D                    Gibbon  cctct-
B D                    Rhesus  cctct-
B D       Crab-eating macaque  cctct-
B D                    Baboon  cctct-
B D              Green monkey  cctct-
B D                  Marmoset  cctct-
B D           Squirrel monkey  cctct-
B D                  Bushbaby  ct----
           Chinese tree shrew  ccact-
       Lesser Egyptian jerboa  gcact-
             Brush-tailed rat  actct-
B D                    Rabbit  act---
B D                       Pig  cctcc-
B D                    Alpaca  -ccat-
B D                   Dolphin  -ccat-
             Tibetan antelope  -ccat-
B D                     Sheep  -ccat-
B D          White rhinoceros  -gcat-
B D                     Panda  -gcag-
B D                   Manatee  -ccacg
B D                    Tenrec  -ctctg
B D                 Armadillo  -ccacc
B D                  Hedgehog  ======
              Golden hamster  ======
B D                      Pika  ======
             Star-nosed mole  ======
B D                     Shrew  ======
                Prairie vole  ======
B D           Chinese hamster  ======
B D                       Rat  ======
B D            Naked mole-rat  ======
         Cape elephant shrew  ======
                  Chinchilla  ------
B D                     Mouse  ======
B D                Guinea pig  ======
         Pundamilia nyererei  ======
B D                    Lizard  ======
B D              Nile tilapia  ======
       Burton's mouthbreeder  ======
B D               Stickleback  ======
          Southern platyfish  ======
B D                 Tetraodon  ======
                    Aardvark  ======
B D                   Wallaby  ======
    Mexican tetra (cavefish)  ======
                 Spotted gar  ======
      Yellowbelly pufferfish  ======
B D                      Fugu  ======
B D                Coelacanth  ======
B D                    Medaka  ======
B D             X. tropicalis  ======
                Weddell seal  ------
  D           Green seaturtle  ======
  D  Chinese softshell turtle  ======
  D              Mallard duck  ======
  D    Spiny softshell turtle  ------
  D            Painted turtle  ------
            Cape golden mole  ======
  D             Scarlet macaw  ======
B D                Budgerigar  ======
  D          Peregrine falcon  ------
  D              Saker falcon  ------
          Tibetan ground jay  ======
  D               Rock pigeon  ======
  D       Collared flycatcher  ======
B D           Tasmanian devil  ======
B D                   Opossum  ======
                Killer whale  ------
              Bactrian camel  ======
B D              Atlantic cod  ------
B D                    Turkey  ------
               Big brown bat  ======
B D                   Chicken  ======
B D       Medium ground finch  ======
B D                  Platypus  ======
B D                       Cow  ------
B D                  Elephant  ======
            Black flying-fox  ======
B D                  Squirrel  ======
        David's myotis (bat)  ======
B D                       Dog  ======
               Domestic goat  ------
B D        American alligator  ======
B D               Zebra finch  ======
              Pacific walrus  ------
B D                   Ferret   ======
B D                       Cat  ------
B D                     Horse  ------

Alignment block 17 of 544 in window, 33031731 - 33031732, 2 bps 
B D                     Human  gg
B D                     Chimp  gg
B D                   Gorilla  gg
B D                 Orangutan  gg
B D                    Gibbon  gg
B D                    Rhesus  gg
B D       Crab-eating macaque  gg
B D                    Baboon  gg
B D              Green monkey  gg
B D                  Marmoset  gg
B D           Squirrel monkey  gg
           Chinese tree shrew  gg
       Lesser Egyptian jerboa  gg
B D                       Rat  ga
             Brush-tailed rat  gg
B D                    Rabbit  -g
B D                       Pig  aa
B D                    Alpaca  gg
B D                   Dolphin  gg
             Tibetan antelope  gg
B D                     Sheep  gg
B D          White rhinoceros  gg
B D                     Panda  gg
B D                   Manatee  -g
B D                 Armadillo  -g
B D                  Hedgehog  ==
              Golden hamster  ==
B D                      Pika  ==
             Star-nosed mole  ==
B D                     Shrew  ==
B D                    Tenrec  --
                Prairie vole  ==
B D           Chinese hamster  ==
B D            Naked mole-rat  ==
         Cape elephant shrew  ==
                  Chinchilla  --
B D                     Mouse  ==
B D                Guinea pig  ==
         Pundamilia nyererei  ==
B D                    Lizard  ==
B D              Nile tilapia  ==
       Burton's mouthbreeder  ==
B D               Stickleback  ==
          Southern platyfish  ==
B D                 Tetraodon  ==
                    Aardvark  ==
B D                   Wallaby  ==
    Mexican tetra (cavefish)  ==
                 Spotted gar  ==
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
B D                Coelacanth  ==
B D                    Medaka  ==
B D             X. tropicalis  ==
                Weddell seal  --
  D           Green seaturtle  ==
  D  Chinese softshell turtle  ==
  D              Mallard duck  ==
  D    Spiny softshell turtle  --
  D            Painted turtle  --
            Cape golden mole  ==
  D             Scarlet macaw  ==
B D                Budgerigar  ==
  D          Peregrine falcon  --
  D              Saker falcon  --
          Tibetan ground jay  ==
  D               Rock pigeon  ==
  D       Collared flycatcher  ==
B D           Tasmanian devil  ==
B D                   Opossum  ==
                Killer whale  --
              Bactrian camel  ==
B D              Atlantic cod  --
B D                    Turkey  --
               Big brown bat  ==
B D                   Chicken  ==
B D       Medium ground finch  ==
B D                  Platypus  ==
B D                       Cow  --
B D                  Elephant  ==
            Black flying-fox  ==
B D                  Squirrel  ==
        David's myotis (bat)  ==
B D                       Dog  ==
               Domestic goat  --
B D        American alligator  ==
B D               Zebra finch  ==
              Pacific walrus  --
B D                   Ferret   ==
B D                       Cat  --
B D                     Horse  --
B D                  Bushbaby  --

Inserts between block 17 and 18 in window
      Lesser Egyptian jerboa 1bp
            Brush-tailed rat 1bp
B D                   Rabbit 7bp

Alignment block 18 of 544 in window, 33031733 - 33031741, 9 bps 
B D                     Human  cctcagca-c
B D                     Chimp  cctcagca-c
B D                   Gorilla  cctcagca-c
B D                 Orangutan  cctcagct-c
B D                    Gibbon  cctcagca-c
B D                    Rhesus  cctcagca-c
B D       Crab-eating macaque  cctcagca-c
B D                    Baboon  cctcagca-c
B D              Green monkey  cctcagca-c
B D                  Marmoset  tctcagca-c
B D           Squirrel monkey  tctcagca-c
B D                  Bushbaby  -----gcacc
           Chinese tree shrew  cctgggaa-g
B D                  Squirrel  ------ct-c
       Lesser Egyptian jerboa  ------ct-c
               Golden hamster  ------cc-a
B D                       Rat  ------ct-t
             Brush-tailed rat  ------ct-c
B D                    Rabbit  ------ct-c
B D                       Pig  cccccgcc-c
B D                    Alpaca  cctctgtc-c
B D                   Dolphin  cctctgtc-c
             Tibetan antelope  tctctgcc-c
B D                     Sheep  tctctgcc-c
B D          White rhinoceros  cctctgca-c
B D                     Panda  cctctgtg-c
B D                   Manatee  cctctacgcc
B D                    Tenrec  ---------c
B D                 Armadillo  cctccgcg-c
B D                  Hedgehog  ==========
B D                      Pika  ==========
             Star-nosed mole  ==========
B D                     Shrew  ==========
                Prairie vole  ==========
B D           Chinese hamster  ==========
B D            Naked mole-rat  ==========
         Cape elephant shrew  ==========
                  Chinchilla  ----------
B D                     Mouse  ==========
B D                Guinea pig  ==========
         Pundamilia nyererei  ==========
B D                    Lizard  ==========
B D              Nile tilapia  ==========
       Burton's mouthbreeder  ==========
B D               Stickleback  ==========
          Southern platyfish  ==========
B D                 Tetraodon  ==========
                    Aardvark  ==========
B D                   Wallaby  ==========
    Mexican tetra (cavefish)  ==========
                 Spotted gar  ==========
      Yellowbelly pufferfish  ==========
B D                      Fugu  ==========
B D                Coelacanth  ==========
B D                    Medaka  ==========
B D             X. tropicalis  ==========
                Weddell seal  ----------
  D           Green seaturtle  ==========
  D  Chinese softshell turtle  ==========
  D              Mallard duck  ==========
  D    Spiny softshell turtle  ----------
  D            Painted turtle  ----------
            Cape golden mole  ==========
  D             Scarlet macaw  ==========
B D                Budgerigar  ==========
  D          Peregrine falcon  ----------
  D              Saker falcon  ----------
          Tibetan ground jay  ==========
  D               Rock pigeon  ==========
  D       Collared flycatcher  ==========
B D           Tasmanian devil  ==========
B D                   Opossum  ==========
                Killer whale  ----------
              Bactrian camel  ==========
B D              Atlantic cod  ----------
B D                    Turkey  ----------
               Big brown bat  ==========
B D                   Chicken  ==========
B D       Medium ground finch  ==========
B D                  Platypus  ==========
B D                       Cow  ----------
B D                  Elephant  ==========
            Black flying-fox  ==========
        David's myotis (bat)  ==========
B D                       Dog  ==========
               Domestic goat  ----------
B D        American alligator  ==========
B D               Zebra finch  ==========
              Pacific walrus  ----------
B D                   Ferret   ==========
B D                       Cat  ----------
B D                     Horse  ----------

Inserts between block 18 and 19 in window
B D                 Squirrel 4bp
      Lesser Egyptian jerboa 7bp
              Golden hamster 7bp
B D                      Rat 7bp

Alignment block 19 of 544 in window, 33031742 - 33031747, 6 bps 
B D                     Human  ccc-----agg
B D                     Chimp  ccc-----agg
B D                   Gorilla  ccc-----agg
B D                 Orangutan  ccc-----agg
B D                    Gibbon  ccc-----agg
B D                    Rhesus  cct-----agg
B D       Crab-eating macaque  cct-----agg
B D                    Baboon  cct-----agg
B D              Green monkey  cct-----agg
B D                  Marmoset  ccc-----agg
B D           Squirrel monkey  ccc-----agg
B D                  Bushbaby  ccc-----agg
           Chinese tree shrew  ccc-----agg
       Lesser Egyptian jerboa  ctc-----cgg
               Golden hamster  cca-----agg
B D                       Rat  cca-----gga
B D            Naked mole-rat  ccc-----agg
             Brush-tailed rat  ccc--------
B D                    Rabbit  cct-----aaa
B D                       Pig  ccccgcaaaaa
B D                    Alpaca  ccct----aga
B D                   Dolphin  tcc-----aga
             Tibetan antelope  tcc-----agg
B D                     Sheep  tcc-----agg
B D          White rhinoceros  ccc-----agg
B D                     Panda  tcc-----aga
               Pacific walrus  ---------ga
                 Weddell seal  ---------ga
B D                   Manatee  ccc-----agg
B D                    Tenrec  ccc-----agg
B D                 Armadillo  ccc-----cgg
B D                  Hedgehog  ===========
B D                      Pika  ===========
             Star-nosed mole  ===========
B D                     Shrew  ===========
                Prairie vole  ===========
B D           Chinese hamster  ===========
         Cape elephant shrew  ===========
                  Chinchilla  -----------
B D                     Mouse  ===========
B D                Guinea pig  ===========
         Pundamilia nyererei  ===========
B D                    Lizard  ===========
B D              Nile tilapia  ===========
       Burton's mouthbreeder  ===========
B D               Stickleback  ===========
          Southern platyfish  ===========
B D                 Tetraodon  ===========
                    Aardvark  ===========
B D                   Wallaby  ===========
    Mexican tetra (cavefish)  ===========
                 Spotted gar  ===========
      Yellowbelly pufferfish  ===========
B D                      Fugu  ===========
B D                Coelacanth  ===========
B D                    Medaka  ===========
B D             X. tropicalis  ===========
  D           Green seaturtle  ===========
  D  Chinese softshell turtle  ===========
  D              Mallard duck  ===========
  D    Spiny softshell turtle  -----------
  D            Painted turtle  -----------
            Cape golden mole  ===========
  D             Scarlet macaw  ===========
B D                Budgerigar  ===========
  D          Peregrine falcon  -----------
  D              Saker falcon  -----------
          Tibetan ground jay  ===========
  D               Rock pigeon  ===========
  D       Collared flycatcher  ===========
B D           Tasmanian devil  ===========
B D                   Opossum  ===========
                Killer whale  -----------
              Bactrian camel  ===========
B D              Atlantic cod  -----------
B D                    Turkey  -----------
               Big brown bat  ===========
B D                   Chicken  ===========
B D       Medium ground finch  ===========
B D                  Platypus  ===========
B D                       Cow  -----------
B D                  Elephant  ===========
            Black flying-fox  ===========
B D                  Squirrel  ===========
        David's myotis (bat)  ===========
B D                       Dog  ===========
               Domestic goat  -----------
B D        American alligator  ===========
B D               Zebra finch  ===========
B D                   Ferret   ===========
B D                       Cat  -----------
B D                     Horse  -----------

Alignment block 20 of 544 in window, 33031748 - 33031751, 4 bps 
B D                     Human  gcat
B D                     Chimp  gcat
B D                   Gorilla  gcat
B D                 Orangutan  gcat
B D                    Gibbon  gcat
B D                    Rhesus  gcat
B D       Crab-eating macaque  gcat
B D                    Baboon  gcat
B D              Green monkey  gcat
B D                  Marmoset  gcac
B D           Squirrel monkey  gcac
B D                  Bushbaby  acac
           Chinese tree shrew  gcac
       Lesser Egyptian jerboa  gcac
               Golden hamster  c---
B D                       Rat  acac
B D            Naked mole-rat  acac
B D                    Rabbit  gcac
B D                       Pig  aaac
B D                    Alpaca  gcac
B D                   Dolphin  gcac
             Tibetan antelope  gcac
B D                     Sheep  gcac
B D          White rhinoceros  gcac
B D                       Cat  accc
B D                     Panda  gccc
               Pacific walrus  gccc
                 Weddell seal  gccc
             Black flying-fox  gcac
B D                   Manatee  gcac
B D                    Tenrec  gcaa
B D                 Armadillo  atgc
B D                  Hedgehog  ====
B D                      Pika  ====
             Star-nosed mole  ====
B D                     Shrew  ====
                Prairie vole  ====
B D           Chinese hamster  ====
         Cape elephant shrew  ====
                  Chinchilla  ----
B D                     Mouse  ====
            Brush-tailed rat  ----
B D                Guinea pig  ====
         Pundamilia nyererei  ====
B D                    Lizard  ====
B D              Nile tilapia  ====
       Burton's mouthbreeder  ====
B D               Stickleback  ====
          Southern platyfish  ====
B D                 Tetraodon  ====
                    Aardvark  ====
B D                   Wallaby  ====
    Mexican tetra (cavefish)  ====
                 Spotted gar  ====
      Yellowbelly pufferfish  ====
B D                      Fugu  ====
B D                Coelacanth  ====
B D                    Medaka  ====
B D             X. tropicalis  ====
  D           Green seaturtle  ====
  D  Chinese softshell turtle  ====
  D              Mallard duck  ====
  D    Spiny softshell turtle  ----
  D            Painted turtle  ----
            Cape golden mole  ====
  D             Scarlet macaw  ====
B D                Budgerigar  ====
  D          Peregrine falcon  ----
  D              Saker falcon  ----
          Tibetan ground jay  ====
  D               Rock pigeon  ====
  D       Collared flycatcher  ====
B D           Tasmanian devil  ====
B D                   Opossum  ====
                Killer whale  ----
              Bactrian camel  ====
B D              Atlantic cod  ----
B D                    Turkey  ----
               Big brown bat  ====
B D                   Chicken  ====
B D       Medium ground finch  ====
B D                  Platypus  ====
B D                       Cow  ----
B D                  Elephant  ====
B D                  Squirrel  ====
        David's myotis (bat)  ====
B D                       Dog  ====
               Domestic goat  ----
B D        American alligator  ====
B D               Zebra finch  ====
B D                   Ferret   ====
B D                     Horse  ----

Inserts between block 20 and 21 in window
B D                      Cat 4bp

Alignment block 21 of 544 in window, 33031752 - 33031753, 2 bps 
B D                     Human  tg
B D                     Chimp  tg
B D                   Gorilla  tg
B D                 Orangutan  tg
B D                    Gibbon  tg
B D                    Rhesus  tg
B D       Crab-eating macaque  tg
B D                    Baboon  tg
B D              Green monkey  tg
B D                  Marmoset  tg
B D           Squirrel monkey  tg
B D                  Bushbaby  tg
           Chinese tree shrew  tg
       Lesser Egyptian jerboa  tg
B D                       Rat  cg
B D            Naked mole-rat  tg
B D                Guinea pig  ta
             Brush-tailed rat  ta
B D                    Rabbit  tg
B D                       Pig  tg
B D                    Alpaca  tg
B D                   Dolphin  tg
             Tibetan antelope  gg
B D                     Sheep  gg
B D          White rhinoceros  tg
B D                       Cat  ag
B D                     Panda  tg
               Pacific walrus  tg
                 Weddell seal  tg
             Black flying-fox  tg
B D                   Manatee  tg
B D                    Tenrec  ag
B D                 Armadillo  ta
B D                  Hedgehog  ==
              Golden hamster  --
B D                      Pika  ==
             Star-nosed mole  ==
B D                     Shrew  ==
                Prairie vole  ==
B D           Chinese hamster  ==
         Cape elephant shrew  ==
                  Chinchilla  --
B D                     Mouse  ==
         Pundamilia nyererei  ==
B D                    Lizard  ==
B D              Nile tilapia  ==
       Burton's mouthbreeder  ==
B D               Stickleback  ==
          Southern platyfish  ==
B D                 Tetraodon  ==
                    Aardvark  ==
B D                   Wallaby  ==
    Mexican tetra (cavefish)  ==
                 Spotted gar  ==
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
B D                Coelacanth  ==
B D                    Medaka  ==
B D             X. tropicalis  ==
  D           Green seaturtle  ==
  D  Chinese softshell turtle  ==
  D              Mallard duck  ==
  D    Spiny softshell turtle  --
  D            Painted turtle  --
            Cape golden mole  ==
  D             Scarlet macaw  ==
B D                Budgerigar  ==
  D          Peregrine falcon  --
  D              Saker falcon  --
          Tibetan ground jay  ==
  D               Rock pigeon  ==
  D       Collared flycatcher  ==
B D           Tasmanian devil  ==
B D                   Opossum  ==
                Killer whale  --
              Bactrian camel  ==
B D              Atlantic cod  --
B D                    Turkey  --
               Big brown bat  ==
B D                   Chicken  ==
B D       Medium ground finch  ==
B D                  Platypus  ==
B D                       Cow  --
B D                  Elephant  ==
B D                  Squirrel  ==
        David's myotis (bat)  ==
B D                       Dog  ==
               Domestic goat  --
B D        American alligator  ==
B D               Zebra finch  ==
B D                   Ferret   ==
B D                     Horse  --

Inserts between block 21 and 22 in window
B D                      Pig 19bp
B D                   Alpaca 5bp
B D                  Dolphin 6bp
            Tibetan antelope 6bp
B D                    Sheep 6bp

Alignment block 22 of 544 in window, 33031754 - 33031754, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  t
           Chinese tree shrew  c
       Lesser Egyptian jerboa  t
B D                       Rat  t
B D            Naked mole-rat  c
B D                Guinea pig  c
             Brush-tailed rat  c
B D                    Rabbit  t
B D                       Pig  t
B D          White rhinoceros  t
B D                       Cat  t
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  c
B D                   Manatee  t
B D                    Tenrec  t
B D                 Armadillo  a
B D                  Hedgehog  =
              Golden hamster  -
B D                      Pika  =
             Star-nosed mole  =
B D                     Shrew  =
                Prairie vole  =
B D           Chinese hamster  =
         Cape elephant shrew  =
                  Chinchilla  -
B D                     Mouse  =
         Pundamilia nyererei  =
B D                    Lizard  =
B D              Nile tilapia  =
       Burton's mouthbreeder  =
B D               Stickleback  =
          Southern platyfish  =
B D                 Tetraodon  =
B D                   Dolphin  =
                    Aardvark  =
B D                   Wallaby  =
    Mexican tetra (cavefish)  =
                 Spotted gar  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D                Coelacanth  =
B D                    Medaka  =
B D             X. tropicalis  =
  D           Green seaturtle  =
  D  Chinese softshell turtle  =
  D              Mallard duck  =
  D    Spiny softshell turtle  -
  D            Painted turtle  -
            Cape golden mole  =
  D             Scarlet macaw  =
B D                Budgerigar  =
  D          Peregrine falcon  -
  D              Saker falcon  -
          Tibetan ground jay  =
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D           Tasmanian devil  =
B D                   Opossum  =
                Killer whale  -
              Bactrian camel  =
B D              Atlantic cod  -
B D                    Turkey  -
               Big brown bat  =
B D                   Chicken  =
B D       Medium ground finch  =
B D                  Platypus  =
B D                     Sheep  =
B D                       Cow  -
            Tibetan antelope  =
B D                  Elephant  =
B D                  Squirrel  =
        David's myotis (bat)  =
B D                       Dog  =
               Domestic goat  -
B D        American alligator  =
B D               Zebra finch  =
B D                    Alpaca  =
B D                   Ferret   =
B D                     Horse  -

Inserts between block 22 and 23 in window
B D           Naked mole-rat 12bp
B D                   Rabbit 1bp

Alignment block 23 of 544 in window, 33031755 - 33031760, 6 bps 
B D                     Human  -ccct--gg
B D                     Chimp  -ccct--gg
B D                   Gorilla  -ccct--gg
B D                 Orangutan  -ccct--gg
B D                    Gibbon  -ccct--gg
B D                    Rhesus  -ccct--gg
B D       Crab-eating macaque  -ccct--gg
B D                    Baboon  -ccct--gg
B D              Green monkey  -ccct--gg
B D                  Marmoset  -ccct--gg
B D           Squirrel monkey  -ccct--gg
B D                  Bushbaby  -cccc--ac
           Chinese tree shrew  -ccc----a
       Lesser Egyptian jerboa  -cccc--aa
B D                       Rat  -------ga
B D            Naked mole-rat  -ccct--gt
B D                Guinea pig  -ctct--gt
                   Chinchilla  -ctct--gt
             Brush-tailed rat  -ctct--gt
B D                    Rabbit  -cccg--g-
B D                       Pig  -ct------
B D          White rhinoceros  -cctcag--
B D                       Cat  -tgaa----
B D                     Panda  -cctc----
               Pacific walrus  -cctc----
                 Weddell seal  -cctc----
             Black flying-fox  -cagtgg--
B D                   Manatee  catcc--g-
B D                    Tenrec  cccct--g-
B D                 Armadillo  ctcca--g-
B D                  Hedgehog  =========
              Golden hamster  ---------
B D                      Pika  =========
             Star-nosed mole  =========
B D                     Shrew  =========
                Prairie vole  =========
B D           Chinese hamster  =========
         Cape elephant shrew  =========
B D                     Mouse  =========
         Pundamilia nyererei  =========
B D                    Lizard  =========
B D              Nile tilapia  =========
       Burton's mouthbreeder  =========
B D               Stickleback  =========
          Southern platyfish  =========
B D                 Tetraodon  =========
B D                   Dolphin  =========
                    Aardvark  =========
B D                   Wallaby  =========
    Mexican tetra (cavefish)  =========
                 Spotted gar  =========
      Yellowbelly pufferfish  =========
B D                      Fugu  =========
B D                Coelacanth  =========
B D                    Medaka  =========
B D             X. tropicalis  =========
  D           Green seaturtle  =========
  D  Chinese softshell turtle  =========
  D              Mallard duck  =========
  D    Spiny softshell turtle  ---------
  D            Painted turtle  ---------
            Cape golden mole  =========
  D             Scarlet macaw  =========
B D                Budgerigar  =========
  D          Peregrine falcon  ---------
  D              Saker falcon  ---------
          Tibetan ground jay  =========
  D               Rock pigeon  =========
  D       Collared flycatcher  =========
B D           Tasmanian devil  =========
B D                   Opossum  =========
                Killer whale  ---------
              Bactrian camel  =========
B D              Atlantic cod  ---------
B D                    Turkey  ---------
               Big brown bat  =========
B D                   Chicken  =========
B D       Medium ground finch  =========
B D                  Platypus  =========
B D                     Sheep  =========
B D                       Cow  ---------
            Tibetan antelope  =========
B D                  Elephant  =========
B D                  Squirrel  =========
        David's myotis (bat)  =========
B D                       Dog  =========
               Domestic goat  ---------
B D        American alligator  =========
B D               Zebra finch  =========
B D                    Alpaca  =========
B D                   Ferret   =========
B D                     Horse  ---------

Inserts between block 23 and 24 in window
B D                      Rat 8bp

Alignment block 24 of 544 in window, 33031761 - 33031764, 4 bps 
B D                     Human  gctc
B D                     Chimp  gctc
B D                   Gorilla  gctc
B D                 Orangutan  gctc
B D                    Gibbon  gctc
B D                    Rhesus  gctc
B D       Crab-eating macaque  gctc
B D                    Baboon  gctc
B D              Green monkey  gctc
B D                  Marmoset  gctc
B D           Squirrel monkey  gctc
B D                  Bushbaby  actc
           Chinese tree shrew  gctt
       Lesser Egyptian jerboa  gcac
                 Prairie vole  --gt
               Golden hamster  ---t
B D                       Rat  --gc
B D            Naked mole-rat  ---c
B D                Guinea pig  ---c
                   Chinchilla  ---c
             Brush-tailed rat  ---t
B D                    Rabbit  --gt
B D                       Pig  gccc
B D                    Alpaca  -ctt
B D                   Dolphin  -ctc
             Tibetan antelope  -ctc
B D                     Sheep  -ctc
B D          White rhinoceros  gctc
B D                       Cat  gctc
B D                     Panda  cctc
               Pacific walrus  cctc
                 Weddell seal  cctc
             Black flying-fox  gctc
B D                   Manatee  gctc
B D                    Tenrec  catc
B D                 Armadillo  gctc
B D                  Hedgehog  ====
B D                      Pika  ====
             Star-nosed mole  ====
B D                     Shrew  ====
B D           Chinese hamster  ====
         Cape elephant shrew  ====
B D                     Mouse  ====
         Pundamilia nyererei  ====
B D                    Lizard  ====
B D              Nile tilapia  ====
       Burton's mouthbreeder  ====
B D               Stickleback  ====
          Southern platyfish  ====
B D                 Tetraodon  ====
                    Aardvark  ====
B D                   Wallaby  ====
    Mexican tetra (cavefish)  ====
                 Spotted gar  ====
      Yellowbelly pufferfish  ====
B D                      Fugu  ====
B D                Coelacanth  ====
B D                    Medaka  ====
B D             X. tropicalis  ====
  D           Green seaturtle  ====
  D  Chinese softshell turtle  ====
  D              Mallard duck  ====
  D    Spiny softshell turtle  ----
  D            Painted turtle  ----
            Cape golden mole  ====
  D             Scarlet macaw  ====
B D                Budgerigar  ====
  D          Peregrine falcon  ----
  D              Saker falcon  ----
          Tibetan ground jay  ====
  D               Rock pigeon  ====
  D       Collared flycatcher  ====
B D           Tasmanian devil  ====
B D                   Opossum  ====
                Killer whale  ----
              Bactrian camel  ====
B D              Atlantic cod  ----
B D                    Turkey  ----
               Big brown bat  ====
B D                   Chicken  ====
B D       Medium ground finch  ====
B D                  Platypus  ====
B D                       Cow  ----
B D                  Elephant  ====
B D                  Squirrel  ====
        David's myotis (bat)  ====
B D                       Dog  ====
               Domestic goat  ----
B D        American alligator  ====
B D               Zebra finch  ====
B D                   Ferret   ====
B D                     Horse  ----

Inserts between block 24 and 25 in window
      Lesser Egyptian jerboa 1bp
                Prairie vole 2bp
              Golden hamster 1bp
B D                      Rat 10bp
B D           Naked mole-rat 3bp
B D               Guinea pig 3bp
                  Chinchilla 3bp
            Brush-tailed rat 3bp
B D                   Rabbit 2bp

Alignment block 25 of 544 in window, 33031765 - 33031786, 22 bps 
B D                     Human  ctcactctctcatatgggcag---g
B D                     Chimp  ctcactctctcatatgggcag---g
B D                   Gorilla  ctcactctctcatatgggcag---a
B D                 Orangutan  ctcactctctcatatgggcag---g
B D                    Gibbon  ctcactctctcatatggacag---g
B D                    Rhesus  ctcactctctcacatgggcag---g
B D       Crab-eating macaque  ctcactctctcacatgggcag---g
B D                    Baboon  ctcactctctcacatgggcag---g
B D              Green monkey  ctcactctctcacatgggcag---g
B D                  Marmoset  ctcactctctcaggtgggcag---g
B D           Squirrel monkey  ctcactctctcatgtgggcag---g
B D                  Bushbaby  cccaggctctcatgtgggccg---g
           Chinese tree shrew  tctagtctttcctataagcag---a
       Lesser Egyptian jerboa  ttccatctctcaaaagggcaa---g
                 Prairie vole  cccactctgcccatagggccc---a
B D           Chinese hamster  cccactctccccataaggccc---a
               Golden hamster  cccactctctccacagggccc---a
B D                       Rat  acgaccctcc--------ccc---a
B D            Naked mole-rat  ccttctctctcataggagcagcagg
B D                Guinea pig  cctacacacccagataggccg---g
                   Chinchilla  gctactctctcagaggagcaa---g
             Brush-tailed rat  actactctttcataagagcaa----
B D                    Rabbit  ctcattctctcacacgggcag---g
B D                       Pig  tgcactccattact-gggcag---g
B D                    Alpaca  ctcactcccttcctggggcag---g
               Bactrian camel  ---------ttcctggggcag---g
B D                   Dolphin  ttcactcccttact-gggcag---c
             Tibetan antelope  ccctctcacttact-gggcag----
B D                     Sheep  ccctctcacttgct-gggcag----
B D          White rhinoceros  ctcactcctttact-gggcag---g
B D                       Cat  tacattct----tg-ggacag---c
B D                     Panda  ctcattctcttact-gggcag---g
               Pacific walrus  ctcactcccttact-gggcag---g
                 Weddell seal  ctcactcccttact-gggcag---g
             Black flying-fox  ctcgctcccttact-ggtcag---g
B D                   Manatee  --ccactccacatctgggcag---a
B D                    Tenrec  --tacgccttcatctgggcag---a
B D                 Armadillo  -tccacccttcctctgggcag---g
B D                  Hedgehog  =========================
B D                      Pika  =========================
             Star-nosed mole  =========================
B D                     Shrew  =========================
         Cape elephant shrew  =========================
B D                     Mouse  =========================
         Pundamilia nyererei  =========================
B D                    Lizard  =========================
B D              Nile tilapia  =========================
       Burton's mouthbreeder  =========================
B D               Stickleback  =========================
          Southern platyfish  =========================
B D                 Tetraodon  =========================
                    Aardvark  =========================
B D                   Wallaby  =========================
    Mexican tetra (cavefish)  =========================
                 Spotted gar  =========================
      Yellowbelly pufferfish  =========================
B D                      Fugu  =========================
B D                Coelacanth  =========================
B D                    Medaka  =========================
B D             X. tropicalis  =========================
  D           Green seaturtle  =========================
  D  Chinese softshell turtle  =========================
  D              Mallard duck  =========================
  D    Spiny softshell turtle  -------------------------
  D            Painted turtle  -------------------------
            Cape golden mole  =========================
  D             Scarlet macaw  =========================
B D                Budgerigar  =========================
  D          Peregrine falcon  -------------------------
  D              Saker falcon  -------------------------
          Tibetan ground jay  =========================
  D               Rock pigeon  =========================
  D       Collared flycatcher  =========================
B D           Tasmanian devil  =========================
B D                   Opossum  =========================
                Killer whale  -------------------------
B D              Atlantic cod  -------------------------
B D                    Turkey  -------------------------
               Big brown bat  =========================
B D                   Chicken  =========================
B D       Medium ground finch  =========================
B D                  Platypus  =========================
B D                       Cow  -------------------------
B D                  Elephant  =========================
B D                  Squirrel  =========================
        David's myotis (bat)  =========================
B D                       Dog  =========================
               Domestic goat  -------------------------
B D        American alligator  =========================
B D               Zebra finch  =========================
B D                   Ferret   =========================
B D                     Horse  -------------------------

Inserts between block 25 and 26 in window
B D                   Rabbit 4bp

Alignment block 26 of 544 in window, 33031787 - 33031790, 4 bps 
B D                     Human  agcc
B D                     Chimp  agcc
B D                   Gorilla  agcc
B D                 Orangutan  agcc
B D                    Gibbon  agcc
B D                    Rhesus  agcc
B D       Crab-eating macaque  agcc
B D                    Baboon  agcc
B D              Green monkey  agcc
B D                  Marmoset  agcc
B D           Squirrel monkey  agcc
B D                  Bushbaby  agtc
           Chinese tree shrew  gatc
       Lesser Egyptian jerboa  agtc
                 Prairie vole  agtc
B D           Chinese hamster  agtc
               Golden hamster  agtc
B D                       Rat  ttcc
B D            Naked mole-rat  agtc
B D                Guinea pig  agcc
                   Chinchilla  agtc
B D                       Pig  ggat
B D                    Alpaca  agac
               Bactrian camel  agac
B D                   Dolphin  agac
             Tibetan antelope  -gag
B D                     Sheep  -gag
B D          White rhinoceros  agtc
B D                       Cat  aa--
B D                     Panda  ggtc
               Pacific walrus  aatc
                 Weddell seal  aatc
             Black flying-fox  agtc
B D                   Manatee  agtc
B D                    Tenrec  agtc
B D                 Armadillo  ggtc
B D                  Hedgehog  ====
B D                      Pika  ====
             Star-nosed mole  ====
B D                     Shrew  ====
B D                    Rabbit  ====
         Cape elephant shrew  ====
B D                     Mouse  ====
            Brush-tailed rat  ----
         Pundamilia nyererei  ====
B D                    Lizard  ====
B D              Nile tilapia  ====
       Burton's mouthbreeder  ====
B D               Stickleback  ====
          Southern platyfish  ====
B D                 Tetraodon  ====
                    Aardvark  ====
B D                   Wallaby  ====
    Mexican tetra (cavefish)  ====
                 Spotted gar  ====
      Yellowbelly pufferfish  ====
B D                      Fugu  ====
B D                Coelacanth  ====
B D                    Medaka  ====
B D             X. tropicalis  ====
  D           Green seaturtle  ====
  D  Chinese softshell turtle  ====
  D              Mallard duck  ====
  D    Spiny softshell turtle  ----
  D            Painted turtle  ----
            Cape golden mole  ====
  D             Scarlet macaw  ====
B D                Budgerigar  ====
  D          Peregrine falcon  ----
  D              Saker falcon  ----
          Tibetan ground jay  ====
  D               Rock pigeon  ====
  D       Collared flycatcher  ====
B D           Tasmanian devil  ====
B D                   Opossum  ====
                Killer whale  ----
B D              Atlantic cod  ----
B D                    Turkey  ----
               Big brown bat  ====
B D                   Chicken  ====
B D       Medium ground finch  ====
B D                  Platypus  ====
B D                       Cow  ----
B D                  Elephant  ====
B D                  Squirrel  ====
        David's myotis (bat)  ====
B D                       Dog  ====
               Domestic goat  ----
B D        American alligator  ====
B D               Zebra finch  ====
B D                   Ferret   ====
B D                     Horse  ----

Alignment block 27 of 544 in window, 33031791 - 33031805, 15 bps 
B D                     Human  acagagaaatg------------------------aca-c
B D                     Chimp  aaagagaaatg------------------------aca-c
B D                   Gorilla  acagagaaatg------------------------aca-c
B D                 Orangutan  acagagaaatg------------------------aca-c
B D                    Gibbon  acagagaagtg------------------------aca-c
B D                    Rhesus  gcagagaaatg------------------------aca-c
B D       Crab-eating macaque  gcagagaaatg------------------------aca-c
B D                    Baboon  gca-------------------------------------
B D              Green monkey  gcagagaaatg------------------------aca-c
B D                  Marmoset  acagagaaatg------------------------aca-c
B D           Squirrel monkey  acagagaaatg------------------------aca-a
B D                  Bushbaby  acaaagaaatg------------------------cca-a
           Chinese tree shrew  acagagaagtg------------------------gtg-a
       Lesser Egyptian jerboa  -acagggaaggaaaaaaaaaatttaaaaaggatgctc---
                 Prairie vole  -ctagcaaagg------------------ggctgata---
B D           Chinese hamster  -ctggaaaagg------------------gactgatg---
               Golden hamster  -ctagaaaagg------------------gactgatg---
B D                       Rat  -ct-------------------------------------
B D            Naked mole-rat  -ccgggaaaag------------------------tga-c
B D                Guinea pig  -acaggaaaag------------------------tgc-c
                   Chinchilla  -tcaggaaaag------------------------tga-t
             Brush-tailed rat  -----gaaaag------------------------tgc-c
B D                    Rabbit  gcaggaaaaag------------------------agg-a
B D                       Pig  gca-agaaatg------------------------ctg-a
B D                    Alpaca  acagagaaatg------------------------acc-g
               Bactrian camel  acagagacgtg------------------------acc-g
B D                   Dolphin  acagagaaatg------------------------act-g
             Tibetan antelope  acagagaaatg------------------------agg-a
B D                     Sheep  acagagaaatg------------------------agg-a
B D          White rhinoceros  acagagaaatg------------------------acg-a
B D                       Cat  gctgagggaca------------------------aagca
B D                     Panda  accgagaaatg------------------------atg-a
               Pacific walrus  acagagaaatg------------------------atg-a
                 Weddell seal  acagagaaatg------------------------atg-a
             Black flying-fox  acagtgaaagg------------------------acg-c
B D                   Manatee  acagagaaatg------------------------aca-a
B D                    Tenrec  acagagaacta------------------------aca-a
B D                 Armadillo  gaggagaaac--------------------------ca-g
B D                  Hedgehog  ========================================
B D                      Pika  ========================================
             Star-nosed mole  ========================================
B D                     Shrew  ========================================
         Cape elephant shrew  ========================================
B D                     Mouse  ========================================
         Pundamilia nyererei  ========================================
B D                    Lizard  ========================================
B D              Nile tilapia  ========================================
       Burton's mouthbreeder  ========================================
B D               Stickleback  ========================================
          Southern platyfish  ========================================
B D                 Tetraodon  ========================================
                    Aardvark  ========================================
B D                   Wallaby  ========================================
    Mexican tetra (cavefish)  ========================================
                 Spotted gar  ========================================
      Yellowbelly pufferfish  ========================================
B D                      Fugu  ========================================
B D                Coelacanth  ========================================
B D                    Medaka  ========================================
B D             X. tropicalis  ========================================
  D           Green seaturtle  ========================================
  D  Chinese softshell turtle  ========================================
  D              Mallard duck  ========================================
  D    Spiny softshell turtle  ----------------------------------------
  D            Painted turtle  ----------------------------------------
            Cape golden mole  ========================================
  D             Scarlet macaw  ========================================
B D                Budgerigar  ========================================
  D          Peregrine falcon  ----------------------------------------
  D              Saker falcon  ----------------------------------------
          Tibetan ground jay  ========================================
  D               Rock pigeon  ========================================
  D       Collared flycatcher  ========================================
B D           Tasmanian devil  ========================================
B D                   Opossum  ========================================
                Killer whale  ----------------------------------------
B D              Atlantic cod  ----------------------------------------
B D                    Turkey  ----------------------------------------
               Big brown bat  ========================================
B D                   Chicken  ========================================
B D       Medium ground finch  ========================================
B D                  Platypus  ========================================
B D                       Cow  ----------------------------------------
B D                  Elephant  ========================================
B D                  Squirrel  ========================================
        David's myotis (bat)  ========================================
B D                       Dog  ========================================
               Domestic goat  ----------------------------------------
B D        American alligator  ========================================
B D               Zebra finch  ========================================
B D                   Ferret   ========================================
B D                     Horse  ----------------------------------------

Alignment block 28 of 544 in window, 33031806 - 33031845, 40 bps 
B D                     Human  ------------------tcccctg-------gactcagtgttgaagga-----c----taa--------
B D                     Chimp  ------------------tctcctg-------gactcagtgttgaagga-----c----taa--------
B D                   Gorilla  ------------------tcccctg-------gactcagtgttgaagga-----c----taa--------
B D                 Orangutan  ------------------tctcctg-------gactcagtgttgaagga-----c----taa--------
B D                    Gibbon  ------------------tcccctg-------gactcagtgttgaagga-----c----taa--------
B D                    Rhesus  ------------------tctcctg-------gactcagtgttgaagga-----c----tca--------
B D       Crab-eating macaque  ------------------tctcctg-------gactcagtgttgaagga-----c----tca--------
B D                    Baboon  ------------------------------------cagtgttgaagga-----c----tca--------
B D              Green monkey  ------------------tctcctg-------gactcagtgttgaagga-----c----tca--------
B D                  Marmoset  ------------------tccccta-------gactc--tgttgaagaa-----c----tca--------
B D           Squirrel monkey  ------------------tccccta-------gactc--ggttgaaaga-----c----tca--------
B D                  Bushbaby  ------------------ttccctg-------g------tgttggagga-----c----tcacgagag--
           Chinese tree shrew  ------------------ttttctg-------ggcaaagttttgaagga-----c----tcagcaaaa--
B D                  Squirrel  ----------------------------------------------------------------------
       Lesser Egyptian jerboa  ------------------ttccatg-------aactcagtatgggagga-----t----tcaccgtgg--
                 Prairie vole  ------------------tcccctg-------ggttcagtgttggagga-----c----tcttggtga--
B D           Chinese hamster  --------------------tcctg-------gactcagtgttggagga-----c----tctcagtgg--
               Golden hamster  --------------------ccctg-------gactga-tg-cagagga-----c----tcccagtgg--
B D                       Rat  --------------------tcatg-------gggtaagcg-----gtc-----c----ttgtagt----
B D            Naked mole-rat  ------------------ttccctt-------gacttcatattggagga-----c----tcactctag--
B D                Guinea pig  ------------------ttccctg-------gacttagtattggagga-----c----tcacgctag--
                   Chinchilla  ------------------tcccctg-------gacttagtgtgggagga-----c----tccctacag--
             Brush-tailed rat  ------------------tcccc-a-------gacttagtatggggaggaggacc----tcactatag--
B D                    Rabbit  ------------------tttcctg-------caccgagtgttggaaga-----c----ttgccagag--
B D                       Pig  ------------------ttccctg-------ggttctgtgttggaggg-----c----acaccggaaca
B D                    Alpaca  ------------------ttccctg-------gagactacgttgaaggg-----c----atgccagaacc
               Bactrian camel  ------------------ttccctg-------gagtctatgttgaaggg-----c----ttgccagaacc
B D                   Dolphin  ------------------ttccctg-------gattctgtgttggagag-----c----atgccagaacc
                 Killer whale  ------------------------------------------------g-----c----atgccagaacc
             Tibetan antelope  ------------------atccctg---gtttgatcctgtgttggaggg-----c----acttgggaacc
B D                       Cow  ----------------------------------------------------------------ggaacc
B D                     Sheep  ------------------atccctg---gtttgatcctgtgttggaggg-----c----acttgggaacc
                Domestic goat  ----------------------------------------------------------------------
B D                     Horse  --------------------------------------------------------------------cc
B D          White rhinoceros  ------------------attcctg-------gactcagtgttggagga-----c----tagccagagcc
B D                       Cat  ------------------ttccctc-------agactaatgttcg-------------------------
B D                     Panda  ------------------ttccctg-------gacacggtgttggagga---------------------
               Pacific walrus  ------------------ttccctg-------ggcacagtgttggagga-----c-----agccagaact
                 Weddell seal  ------------------ttccctg-------ggcacagtgttggagga-----c-----agccagaact
             Black flying-fox  ------------------ttgcctg-------gatg-ggtgctggagga-----tggatgaggcagagtt
B D                   Manatee  ttccctgggtagccagaggtctccgctggaggtactcggtgctggaggc-----t----cccccagagcc
B D                    Tenrec  ttccctgggtagccagaagtctccatcagaaggacttggtactagaggc-----t-----gcccagagcc
B D                 Armadillo  gtccc-------acggaggtccccg-----------------------------------acc---ggct
B D                  Hedgehog  ======================================================================
B D                      Pika  ======================================================================
             Star-nosed mole  ======================================================================
B D                     Shrew  ======================================================================
         Cape elephant shrew  ======================================================================
B D                     Mouse  ======================================================================
         Pundamilia nyererei  ======================================================================
B D                    Lizard  ======================================================================
B D              Nile tilapia  ======================================================================
       Burton's mouthbreeder  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
B D                 Tetraodon  ======================================================================
                    Aardvark  ======================================================================
B D                   Wallaby  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
                 Spotted gar  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                Coelacanth  ======================================================================
B D                    Medaka  ======================================================================
B D             X. tropicalis  ======================================================================
  D           Green seaturtle  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D              Mallard duck  ======================================================================
  D    Spiny softshell turtle  ----------------------------------------------------------------------
  D            Painted turtle  ----------------------------------------------------------------------
            Cape golden mole  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                Budgerigar  ======================================================================
  D          Peregrine falcon  ----------------------------------------------------------------------
  D              Saker falcon  ----------------------------------------------------------------------
          Tibetan ground jay  ======================================================================
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Opossum  ======================================================================
B D              Atlantic cod  ----------------------------------------------------------------------
B D                    Turkey  ----------------------------------------------------------------------
               Big brown bat  ======================================================================
B D                   Chicken  ======================================================================
B D       Medium ground finch  ======================================================================
B D                  Platypus  ======================================================================
B D                  Elephant  ======================================================================
        David's myotis (bat)  ======================================================================
B D                       Dog  ======================================================================
B D        American alligator  ======================================================================
B D               Zebra finch  ======================================================================
B D                   Ferret   ======================================================================

                        Human  --------------------------------------------------------cccctaatgccc
                        Chimp  --------------------------------------------------------cccctaatgccc
                      Gorilla  --------------------------------------------------------cccctaatgccc
                    Orangutan  --------------------------------------------------------cccctaatgccc
                       Gibbon  --------------------------------------------------------cccctaatgccc
                       Rhesus  --------------------------------------------------------cctctaatgctc
          Crab-eating macaque  --------------------------------------------------------cctctaatgctc
                       Baboon  --------------------------------------------------------cctctaatgctc
                 Green monkey  --------------------------------------------------------cctctaatgctc
                     Marmoset  --------------------------------------------------------cctttaatgccc
              Squirrel monkey  --------------------------------------------------------cctttaatgccc
                     Bushbaby  --------------------------------ctgtag--------------gatgccttggctgttc
           Chinese tree shrew  --------------------------------gtgccc--------------agtgcctctgatcctc
                     Squirrel  ---------------------------------attggccagaa--ctccaggataactctgatgccc
       Lesser Egyptian jerboa  --------------------------------gattgagctgca--tttcagggtgcctctgatgccc
                 Prairie vole  --------------------------------gactggcttgag--c--ca--gtacttctgatg-cc
              Chinese hamster  --------------------------------gattcgcttgag--ctataaggtccctctgatg-cc
               Golden hamster  --------------------------------gactggcttgag--c--tagcgtccctctgatg---
                          Rat  ----------------------------------ttggtttggg-----ta-------cctgggg---
               Naked mole-rat  --------------------------------ggttgg---------------atatcactgatgccc
                   Guinea pig  --------------------------------ggttgg---------------gtacttttgatgccc
                   Chinchilla  --------------------------------ggttgg---------------gtacctctgatgccc
             Brush-tailed rat  --------------------------------tgttgg---------------gtacccccgatgccc
                       Rabbit  --------------------------------ctgcag---------------gtgcct---------
                          Pig  cct-----------------------------aggacg--------ctgtcctgcgatgtcagaaccc
                       Alpaca  cca-----------------------------cgggga-g------ctgccctgcgtctctagc-ccc
               Bactrian camel  cca-----------------------------cggggatg------ctgccctgtgtctctagc-ccc
                      Dolphin  cct-----------------------------gggtg---------ttgtcctgcacctctagcgccc
                 Killer whale  cct-----------------------------gggtg---------ttgtcctgcacctctagcgccc
             Tibetan antelope  cctgcggg-----------gtgtgggggggtggggtgg-gaggaaagtgttcaatgcctccagcgccc
                          Cow  cct-------------------------------gtgg-ggggg--gtatcccatgcctccagcgccc
                        Sheep  cctgcgggggcagggggtggc-----------aggtgg-ggggaacgtattccatgcctccagtgccc
                Domestic goat  -------------------gc-----------aggtgg-ggggaacgtgttccatgcctccagcgccc
                        Horse  cct-----------------------------tgggtg--------ctgtagggcgcctctggcaccc
             White rhinoceros  ctt-----------------------------ggggtg--------ctgcagggtgcctctgacgccc
                          Cat  --------------------------------------------------------------------
                        Panda  ----------------------------------------------ctgcccaatgcctctggcgccc
               Pacific walrus  cct-----------------------------tgggtg--------ctgcccaatgcctctggcaccc
                 Weddell seal  cct-----------------------------tgggtg--------ctgcccgatgcctctggcaccc
             Black flying-fox  ccc-----------------------------cgtatg--------gtgc------------------
                      Manatee  cct-----------------------------ggggca-----------ctgtgggccactgtcgcct
                       Tenrec  cct-----------------------------ggggct-----------gccggagccatggatagct
                    Armadillo  gca-----------------------------ggggc------------------gcgtctgacatct
                     Hedgehog  ====================================================================
                         Pika  ====================================================================
              Star-nosed mole  ====================================================================
                        Shrew  ====================================================================
          Cape elephant shrew  ====================================================================
                        Mouse  ====================================================================
          Pundamilia nyererei  ====================================================================
                       Lizard  ====================================================================
                 Nile tilapia  ====================================================================
        Burton's mouthbreeder  ====================================================================
                  Stickleback  ====================================================================
           Southern platyfish  ====================================================================
                    Tetraodon  ====================================================================
                     Aardvark  ====================================================================
                      Wallaby  ====================================================================
     Mexican tetra (cavefish)  ====================================================================
                  Spotted gar  ====================================================================
       Yellowbelly pufferfish  ====================================================================
                         Fugu  ====================================================================
                   Coelacanth  ====================================================================
                       Medaka  ====================================================================
                X. tropicalis  ====================================================================
              Green seaturtle  ====================================================================
     Chinese softshell turtle  ====================================================================
                 Mallard duck  ====================================================================
       Spiny softshell turtle  --------------------------------------------------------------------
               Painted turtle  --------------------------------------------------------------------
             Cape golden mole  ====================================================================
                Scarlet macaw  ====================================================================
                   Budgerigar  ====================================================================
             Peregrine falcon  --------------------------------------------------------------------
                 Saker falcon  --------------------------------------------------------------------
           Tibetan ground jay  ====================================================================
                  Rock pigeon  ====================================================================
          Collared flycatcher  ====================================================================
              Tasmanian devil  ====================================================================
                      Opossum  ====================================================================
                 Atlantic cod  --------------------------------------------------------------------
                       Turkey  --------------------------------------------------------------------
                Big brown bat  ====================================================================
                      Chicken  ====================================================================
          Medium ground finch  ====================================================================
                     Platypus  ====================================================================
                     Elephant  ====================================================================
         David's myotis (bat)  ====================================================================
                          Dog  ====================================================================
           American alligator  ====================================================================
                  Zebra finch  ====================================================================
                      Ferret   ====================================================================

Inserts between block 28 and 29 in window
B D                      Rat 211bp
B D                   Rabbit 7bp

Alignment block 29 of 544 in window, 33031846 - 33031858, 13 bps 
B D                     Human  ----------atggagtt-ggaa--t
B D                     Chimp  ----------atggagtt-ggaa--t
B D                   Gorilla  ----------atggagtt-ggaa--t
B D                 Orangutan  ----------atggagtt-ggaa--t
B D                    Gibbon  ----------acggagtt-ggaa--t
B D                    Rhesus  ----------atggagtt-ggaa--t
B D       Crab-eating macaque  ----------atggagtt-ggaa--t
B D                    Baboon  ----------atggagtt-ggaa--t
B D              Green monkey  ----------atggagtt-ggaa--t
B D                  Marmoset  ----------atggagtt-ggaa--t
B D           Squirrel monkey  ----------gtggagtt-ggca--t
B D                  Bushbaby  ----------agagagtc-agag--t
           Chinese tree shrew  ----------ctagaact-ag-a--t
B D                  Squirrel  ----------agagactt-ggaa--t
       Lesser Egyptian jerboa  ----------atggaatt-agaa--t
                 Prairie vole  ----------accga----ggag--t
B D           Chinese hamster  ----------acaga----ggaa--t
B D            Naked mole-rat  ----------acagaatt-ggaa--c
B D                Guinea pig  ----------acagaatt-ggaa--t
                   Chinchilla  ----------gcagaact-gaaa--t
             Brush-tailed rat  ----------attgaact-ggaa--t
B D                    Rabbit  ----------gaggagtt-gggg--t
B D                      Pika  ----------atggacttggggg--t
B D                       Pig  ----------a-ggaatt-ggaa---
B D                    Alpaca  ----------atagagtc-gaaa---
               Bactrian camel  ----------atagagtt-gaaa---
B D                   Dolphin  ----------atagggct-gaaac--
                 Killer whale  ----------atagagct-gaaac--
             Tibetan antelope  ----------ataaagtt-caaa---
B D                       Cow  ----------ataaagtt-gaaac--
B D                     Sheep  ----------ataaagtt-caaa---
                Domestic goat  ----------ataaagtt-caaa---
B D                     Horse  ----------gtagagtt-ggat-c-
B D          White rhinoceros  ----------agagagct-ggaa-c-
B D                     Panda  ----------gaagagtt-gaaa-c-
               Pacific walrus  ----------atagagtg-gaaa-c-
                 Weddell seal  ----------atagagtg-gaaa-c-
             Black flying-fox  --------------ggtg-ggaa-c-
B D                   Manatee  gtg---gtgtgggaagt---------
B D                    Tenrec  gggggtgggtgggatgt---------
B D                 Armadillo  gagg--gattgggaagc---------
B D                  Hedgehog  ==========================
              Golden hamster  --------------------------
             Star-nosed mole  ==========================
B D                     Shrew  ==========================
B D                       Rat  ==========================
         Cape elephant shrew  ==========================
B D                     Mouse  ==========================
         Pundamilia nyererei  ==========================
B D                    Lizard  ==========================
B D              Nile tilapia  ==========================
       Burton's mouthbreeder  ==========================
B D               Stickleback  ==========================
          Southern platyfish  ==========================
B D                 Tetraodon  ==========================
                    Aardvark  ==========================
B D                   Wallaby  ==========================
    Mexican tetra (cavefish)  ==========================
                 Spotted gar  ==========================
      Yellowbelly pufferfish  ==========================
B D                      Fugu  ==========================
B D                Coelacanth  ==========================
B D                    Medaka  ==========================
B D             X. tropicalis  ==========================
  D           Green seaturtle  ==========================
  D  Chinese softshell turtle  ==========================
  D              Mallard duck  ==========================
  D    Spiny softshell turtle  --------------------------
  D            Painted turtle  --------------------------
            Cape golden mole  ==========================
  D             Scarlet macaw  ==========================
B D                Budgerigar  ==========================
  D          Peregrine falcon  --------------------------
  D              Saker falcon  --------------------------
          Tibetan ground jay  ==========================
  D               Rock pigeon  ==========================
  D       Collared flycatcher  ==========================
B D           Tasmanian devil  ==========================
B D                   Opossum  ==========================
B D              Atlantic cod  --------------------------
B D                    Turkey  --------------------------
               Big brown bat  ==========================
B D                   Chicken  ==========================
B D       Medium ground finch  ==========================
B D                  Platypus  ==========================
B D                  Elephant  ==========================
        David's myotis (bat)  ==========================
B D                       Dog  ==========================
B D        American alligator  ==========================
B D               Zebra finch  ==========================
B D                   Ferret   ==========================
B D                       Cat  --------------------------

Alignment block 30 of 544 in window, 33031859 - 33031883, 25 bps 
B D                     Human  tctgcaccttggggacaggca-------gt-ga
B D                     Chimp  tctgcaccttggggacaggca-------gt-ga
B D                   Gorilla  tctgcaccttggggacaggca-------gt-ga
B D                 Orangutan  tctgcaccgtggggacaggca-------gt-ga
B D                    Gibbon  tctgcaccttggggacaggca-------gt-ga
B D                    Rhesus  tctgcacctcggggacaggca-------gt-ga
B D       Crab-eating macaque  tctgcacctcggggacaggca-------gt-ga
B D                    Baboon  tctgcacctcggggacaggca-------gt-ga
B D              Green monkey  tctgcacctcggggacaggca-------gt-ga
B D                  Marmoset  ttgccaccctgggggcaggca-------gt-ga
B D           Squirrel monkey  tcggcaccctgggggcaggca-------gt-ga
B D                  Bushbaby  tcttcatcctggggatag---------------
           Chinese tree shrew  tct-catcccagtg-----ta-------gt-ga
B D                  Squirrel  tctgcatcccagggacaggca-------gt-ga
       Lesser Egyptian jerboa  tcagtatcccagg---ggaca-------gt-g-
                 Prairie vole  tccacatcctagt----gaca-------ga-ga
B D           Chinese hamster  tccacaccgtagt----gaca-------gt-ga
               Golden hamster  -ccacatcctagt----gaca-------gt-ca
B D            Naked mole-rat  tctccaccctggg----gaca-------gt-aa
B D                Guinea pig  tctccattccagg----gata-------g--aa
                   Chinchilla  tctccatcccagg----gaca-------gg-aa
             Brush-tailed rat  tctccaacccaag----gaaa-------gt-aa
B D                    Rabbit  cccgcatcccaggggcagcca-------gg-ga
B D                      Pika  gccacatcccaggggcaggca-------gt-ga
B D                       Pig  -c----tccctggaacaggca-------gt-ga
B D                    Alpaca  -ctgaatccctgcaacaggca-------gc-aa
               Bactrian camel  -ctgaatccctgcaacaagca-------tc-ga
B D                   Dolphin  tctgaatcccaggaacaggca-------gt-aa
                 Killer whale  tctgaatcccaggaacaggca-------gt-aa
             Tibetan antelope  -ctgaattctggcaactggaa-------gt-ga
B D                       Cow  tctgaattctggcaactggaa-------gt-ga
B D                     Sheep  -ctgaattctggcaactggaa-------gt-ga
                Domestic goat  -ctgaattctggcaactggaa-------gt-ga
B D                     Horse  tccgcatcccagagacaggca-------gt-ga
B D          White rhinoceros  tccacatcccagagacaggca-------gt-gg
B D                       Cat  --tctaggtctggaa----ag-------gt-gt
B D                       Dog  tctccatttctggga----ca-------gt-ga
B D                     Panda  tccacatttctggga----ca-------gc-ga
               Pacific walrus  tccacatttctggga----ca-------gt-ga
                 Weddell seal  tccacatttctggga----ca-------gt-ga
             Black flying-fox  tccacttcccacaga----ca-------gcaaa
B D                   Manatee  tctgggtctc--ggacaggca-------gt-ga
B D                    Tenrec  tccaagtctcagggacaagca-------gc-aa
B D                 Armadillo  tccgggtctcagggacaggcacggcggggc-ga
B D                  Hedgehog  =================================
             Star-nosed mole  =================================
B D                     Shrew  =================================
B D                       Rat  =================================
         Cape elephant shrew  =================================
B D                     Mouse  =================================
         Pundamilia nyererei  =================================
B D                    Lizard  =================================
B D              Nile tilapia  =================================
       Burton's mouthbreeder  =================================
B D               Stickleback  =================================
          Southern platyfish  =================================
B D                 Tetraodon  =================================
                    Aardvark  =================================
B D                   Wallaby  =================================
    Mexican tetra (cavefish)  =================================
                 Spotted gar  =================================
      Yellowbelly pufferfish  =================================
B D                      Fugu  =================================
B D                Coelacanth  =================================
B D                    Medaka  =================================
B D             X. tropicalis  =================================
  D           Green seaturtle  =================================
  D  Chinese softshell turtle  =================================
  D              Mallard duck  =================================
  D    Spiny softshell turtle  ---------------------------------
  D            Painted turtle  ---------------------------------
            Cape golden mole  =================================
  D             Scarlet macaw  =================================
B D                Budgerigar  =================================
  D          Peregrine falcon  ---------------------------------
  D              Saker falcon  ---------------------------------
          Tibetan ground jay  =================================
  D               Rock pigeon  =================================
  D       Collared flycatcher  =================================
B D           Tasmanian devil  =================================
B D                   Opossum  =================================
B D              Atlantic cod  ---------------------------------
B D                    Turkey  ---------------------------------
               Big brown bat  =================================
B D                   Chicken  =================================
B D       Medium ground finch  =================================
B D                  Platypus  =================================
B D                  Elephant  =================================
        David's myotis (bat)  =================================
B D        American alligator  =================================
B D               Zebra finch  =================================
B D                   Ferret   =================================

Inserts between block 30 and 31 in window
B D                Armadillo 3bp

Alignment block 31 of 544 in window, 33031884 - 33031903, 20 bps 
B D                     Human  gcagacgagtgaagtgaacc
B D                     Chimp  gcagacgagtgaagtgaacc
B D                   Gorilla  gcagatgagtgaagtgaacc
B D                 Orangutan  gcagacgagtgaagtgaacc
B D                    Gibbon  gcagatgagtgaagtgaacc
B D                    Rhesus  gcagaggagtgaggcgaacc
B D       Crab-eating macaque  gcagaggagtgaggcgaacc
B D                    Baboon  gcagaggagtgaggcgaacc
B D              Green monkey  gcagaagagtgaagcgaacc
B D                  Marmoset  acagagggctgaagaaaacc
B D           Squirrel monkey  acagaggagtgaagcaaaca
B D                  Bushbaby  -----tgggtaaagcaaacc
           Chinese tree shrew  cacagggggtgaagcaaact
B D                  Squirrel  gcagaagggtgaagtgaact
       Lesser Egyptian jerboa  ------------agcaaaca
                 Prairie vole  gcggaagtgtgaagcaaact
B D           Chinese hamster  actgaagggaaaagcaaact
               Golden hamster  atagagggtaaaagcaaacg
B D            Naked mole-rat  gcagaggggtgagacaaccc
B D                Guinea pig  gcagaagggtgaa--aaact
                   Chinchilla  gcagaggggtgaaacaaacc
             Brush-tailed rat  gcagagggttgaaacaaacc
B D                    Rabbit  gtta--gggtgaggca---c
B D                      Pika  gctg--gcgtgaagcaaatc
B D                       Pig  accaaggggccatgcaaacc
B D                    Alpaca  accaagaggcaaagcagacc
               Bactrian camel  gccaaggggcaaagcagacc
B D                   Dolphin  gccaaggggcaaagcaaagc
                 Killer whale  gccaaggggcaaagcaaagc
             Tibetan antelope  gccaaggggcaaagcaaacc
B D                       Cow  gccaaggggcaaagcaaacc
B D                     Sheep  gccaaggggcaaagcaaacc
                Domestic goat  gccaaggggcaaagcaaacc
B D                     Horse  gcagcggagccaggcaaacc
B D          White rhinoceros  gcaggggggctgagcaagcc
B D                       Cat  tgctgagaccca--------
B D                       Dog  gcccagggacaaagcaaact
B D                     Panda  gcccagggaccaagcaaacc
               Pacific walrus  gaccagccccgggctggtcc
                 Weddell seal  gaccagggaccaagcaaacc
             Black flying-fox  gaggagaggttaagcaaacc
B D                   Manatee  gcattgggaaggtggcatcc
             Cape golden mole  gtagatcagcggttcaaacc
B D                    Tenrec  gcagcagggggctgtcatcc
B D                 Armadillo  --------ggggacgcgggc
B D                  Hedgehog  ====================
             Star-nosed mole  ====================
B D                     Shrew  ====================
B D                       Rat  ====================
         Cape elephant shrew  ====================
B D                     Mouse  ====================
         Pundamilia nyererei  ====================
B D                    Lizard  ====================
B D              Nile tilapia  ====================
       Burton's mouthbreeder  ====================
B D               Stickleback  ====================
          Southern platyfish  ====================
B D                 Tetraodon  ====================
                    Aardvark  ====================
B D                   Wallaby  ====================
    Mexican tetra (cavefish)  ====================
                 Spotted gar  ====================
      Yellowbelly pufferfish  ====================
B D                      Fugu  ====================
B D                Coelacanth  ====================
B D                    Medaka  ====================
B D             X. tropicalis  ====================
  D           Green seaturtle  ====================
  D  Chinese softshell turtle  ====================
  D              Mallard duck  ====================
  D    Spiny softshell turtle  --------------------
  D            Painted turtle  --------------------
  D             Scarlet macaw  ====================
B D                Budgerigar  ====================
  D          Peregrine falcon  --------------------
  D              Saker falcon  --------------------
          Tibetan ground jay  ====================
  D               Rock pigeon  ====================
  D       Collared flycatcher  ====================
B D           Tasmanian devil  ====================
B D                   Opossum  ====================
B D              Atlantic cod  --------------------
B D                    Turkey  --------------------
               Big brown bat  ====================
B D                   Chicken  ====================
B D       Medium ground finch  ====================
B D                  Platypus  ====================
B D                  Elephant  ====================
        David's myotis (bat)  ====================
B D        American alligator  ====================
B D               Zebra finch  ====================
B D                   Ferret   ====================

Inserts between block 31 and 32 in window
          Chinese tree shrew 14bp
B D                 Squirrel 18bp
      Lesser Egyptian jerboa 16bp
                Prairie vole 15bp
B D          Chinese hamster 18bp
              Golden hamster 18bp
B D           Naked mole-rat 53bp
B D               Guinea pig 17bp
                  Chinchilla 7bp
            Brush-tailed rat 17bp

Alignment block 32 of 544 in window, 33031904 - 33031908, 5 bps 
B D                     Human  cacag
B D                     Chimp  cacag
B D                   Gorilla  cacag
B D                 Orangutan  cacag
B D                    Gibbon  cacag
B D                    Rhesus  cacag
B D       Crab-eating macaque  cacag
B D                    Baboon  cacag
B D              Green monkey  cacag
B D                  Marmoset  cacag
B D           Squirrel monkey  cacag
B D                  Bushbaby  cacag
           Chinese tree shrew  ctcag
B D                  Squirrel  tttag
       Lesser Egyptian jerboa  ctcag
B D           Chinese hamster  gctgg
               Golden hamster  gctgg
B D                Guinea pig  tttag
             Brush-tailed rat  tttaa
B D                    Rabbit  --cac
B D                      Pika  --cac
B D                       Pig  ctcac
B D                    Alpaca  ctcac
               Bactrian camel  ctcac
B D                   Dolphin  ttcac
                 Killer whale  ttcac
             Tibetan antelope  ctcac
B D                       Cow  ctcac
B D                     Sheep  ctcac
                Domestic goat  ctcac
B D                     Horse  ctcag
B D          White rhinoceros  ctcag
B D                       Dog  ctcag
B D                     Panda  ctcag
               Pacific walrus  ctcgg
                 Weddell seal  ctcgg
             Black flying-fox  ctcag
B D                   Manatee  cgcag
             Cape golden mole  cac--
B D                    Tenrec  tgcag
B D                 Armadillo  ggcag
B D                  Hedgehog  =====
             Star-nosed mole  =====
B D                     Shrew  =====
                Prairie vole  =====
B D                       Rat  =====
B D            Naked mole-rat  =====
         Cape elephant shrew  =====
                  Chinchilla  =====
B D                     Mouse  =====
         Pundamilia nyererei  =====
B D                    Lizard  =====
B D              Nile tilapia  =====
       Burton's mouthbreeder  =====
B D               Stickleback  =====
          Southern platyfish  =====
B D                 Tetraodon  =====
                    Aardvark  =====
B D                   Wallaby  =====
    Mexican tetra (cavefish)  =====
                 Spotted gar  =====
      Yellowbelly pufferfish  =====
B D                      Fugu  =====
B D                Coelacanth  =====
B D                    Medaka  =====
B D             X. tropicalis  =====
  D           Green seaturtle  =====
  D  Chinese softshell turtle  =====
  D              Mallard duck  =====
  D    Spiny softshell turtle  -----
  D            Painted turtle  -----
  D             Scarlet macaw  =====
B D                Budgerigar  =====
  D          Peregrine falcon  -----
  D              Saker falcon  -----
          Tibetan ground jay  =====
  D               Rock pigeon  =====
  D       Collared flycatcher  =====
B D           Tasmanian devil  =====
B D                   Opossum  =====
B D              Atlantic cod  -----
B D                    Turkey  -----
               Big brown bat  =====
B D                   Chicken  =====
B D       Medium ground finch  =====
B D                  Platypus  =====
B D                  Elephant  =====
        David's myotis (bat)  =====
B D        American alligator  =====
B D               Zebra finch  =====
B D                   Ferret   =====
B D                       Cat  -----

Inserts between block 32 and 33 in window
B D                      Pig 42bp
B D                   Alpaca 43bp
              Bactrian camel 43bp
B D                  Dolphin 40bp
                Killer whale 40bp
            Tibetan antelope 25bp
B D                      Cow 25bp
B D                    Sheep 25bp
               Domestic goat 25bp
B D                    Horse 44bp
B D         White rhinoceros 44bp
B D                      Dog 43bp
B D                    Panda 43bp
              Pacific walrus 43bp
                Weddell seal 43bp
            Black flying-fox 44bp

Alignment block 33 of 544 in window, 33031909 - 33031916, 8 bps 
B D                     Human  agg-----tgt--------------------ca
B D                     Chimp  agg-----tgt--------------------ca