Schema for 1000G Ph3 Vars - 1000 Genomes Phase 3 Integrated Variant Calls: SNVs, Indels, SVs
  Database: hg19    Primary Table: tgpPhase3
VCF File: /gbdb/hg19/1000Genomes/phase3/ALL.chr1.phase3_shapeit2_mvncall_integrated_v5a.20130502.genotypes.vcf.gz
Format description: The fields of a Variant Call Format data line
See the Variant Call Format specification for more details
fielddescription
chromAn identifier from the reference genome
posThe reference position, with the 1st base having position 1
idSemi-colon separated list of unique identifiers where available
refReference base(s)
altComma separated list of alternate non-reference alleles called on at least one of the samples
qualPhred-scaled quality score for the assertion made in ALT. i.e. give -10log_10 prob(call in ALT is wrong)
filterPASS if this position has passed all filters. Otherwise, a semicolon-separated list of codes for filters that fail
infoAdditional information encoded as a semicolon-separated series of short keys with optional comma-separated values
formatIf genotype columns are specified in header, a semicolon-separated list of of short keys starting with GT
genotypesIf genotype columns are specified in header, a tab-separated set of genotype column values; each value is a colon-separated list of values corresponding to keys in the format column

Sample Rows
 
chromposidrefaltqualfilterinfoformatgenotypes
110177rs367896724AAC100PASSAC=2130;AF=0.425319;AN=5008;NS=2504;DP=103152;EAS_AF=0.3363;AMR_AF=0.3602;AFR_AF=0.4909;EUR_AF=0.4056;SAS_AF=0.4949;AA=|||unknow ...GT1|00|10|11|00|01|01|01|01|00|0...
110235rs540431307TTA100PASSAC=6;AF=0.00119808;AN=5008;NS=2504;DP=78015;EAS_AF=0;AMR_AF=0.0014;AFR_AF=0;EUR_AF=0;SAS_AF=0.0051;AA=|||unknown(NO_COVERAGE);VT ...GT0|00|00|00|00|00|00|00|00|00|0...
110352rs555500075TTA100PASSAC=2191;AF=0.4375;AN=5008;NS=2504;DP=88915;EAS_AF=0.4306;AMR_AF=0.4107;AFR_AF=0.4788;EUR_AF=0.4264;SAS_AF=0.4192;AA=|||unknown(N ...GT1|01|00|10|11|01|01|00|00|10|0...
110505rs548419688AT100PASSAC=1;AF=0.000199681;AN=5008;NS=2504;DP=9632;EAS_AF=0;AMR_AF=0;AFR_AF=0.0008;EUR_AF=0;SAS_AF=0;AA=.|||;VT=SNPGT0|00|00|00|00|00|00|00|00|00|0...
110506rs568405545CG100PASSAC=1;AF=0.000199681;AN=5008;NS=2504;DP=9676;EAS_AF=0;AMR_AF=0;AFR_AF=0.0008;EUR_AF=0;SAS_AF=0;AA=.|||;VT=SNPGT0|00|00|00|00|00|00|00|00|00|0...
110511rs534229142GA100PASSAC=1;AF=0.000199681;AN=5008;NS=2504;DP=9869;EAS_AF=0;AMR_AF=0.0014;AFR_AF=0;EUR_AF=0;SAS_AF=0;AA=.|||;VT=SNPGT0|00|00|00|00|00|00|00|00|00|0...
110539rs537182016CA100PASSAC=3;AF=0.000599042;AN=5008;NS=2504;DP=9203;EAS_AF=0;AMR_AF=0.0014;AFR_AF=0;EUR_AF=0.001;SAS_AF=0.001;AA=.|||;VT=SNPGT0|00|00|00|00|00|00|00|00|00|0...
110542rs572818783CT100PASSAC=1;AF=0.000199681;AN=5008;NS=2504;DP=9007;EAS_AF=0.001;AMR_AF=0;AFR_AF=0;EUR_AF=0;SAS_AF=0;AA=.|||;VT=SNPGT0|00|00|00|00|00|00|00|00|00|0...
110579rs538322974CA100PASSAC=1;AF=0.000199681;AN=5008;NS=2504;DP=5502;EAS_AF=0;AMR_AF=0;AFR_AF=0.0008;EUR_AF=0;SAS_AF=0;AA=.|||;VT=SNPGT0|00|00|00|00|00|00|00|00|00|0...
110616rs376342519CCGCCGTTGCAAAGGCGCGCCGC100PASSAC=4973;AF=0.993011;AN=5008;NS=2504;DP=2365;EAS_AF=0.9911;AMR_AF=0.9957;AFR_AF=0.9894;EUR_AF=0.994;SAS_AF=0.9969;VT=INDELGT1|11|11|11|11|11|11|11|11|11|1...

1000G Ph3 Vars (tgpPhase3) Track Description
 

Description

This track shows 84.7 million single nucleotide polymorphisms (SNPs), 3.6 million short insertions/deletions (indels), and 60,000 structural variants discovered by the 1000 Genomes Project through its Phase 3 sequencing of 2,504 genomes from 16 populations worldwide.

The variant genotypes have been phased by the 1000 Genomes Project (i.e., the two alleles of each diploid genotype have been assigned to two haplotypes, one inherited from each parent). This extra information enables a clustering of independent haplotypes by local similarity for display.

Display Conventions

In "dense" mode, a vertical line is drawn at the position of each variant. In "pack" mode, since these variants have been phased, the display shows a clustering of haplotypes in the viewed range, sorted by similarity of alleles weighted by proximity to a central variant. The clustering view can highlight local patterns of linkage.

In the clustering display, each sample's phased diploid genotype is split into two independent haplotypes. Each haplotype is placed in a horizontal row of pixels; when the number of haplotypes exceeds the number of vertical pixels for the track, multiple haplotypes fall in the same pixel row and pixels are averaged across haplotypes.

Each variant is a vertical bar with white (invisible) representing the reference allele and black representing the non-reference allele(s). Tick marks are drawn at the top and bottom of each variant's vertical bar to make the bar more visible when most alleles are reference alleles. The vertical bar for the central variant used in clustering is outlined in purple. In order to avoid long compute times, the range of alleles used in clustering may be limited; alleles used in clustering have purple tick marks at the top and bottom.

The clustering tree is displayed to the left of the main image. It does not represent relatedness of individuals; it simply shows the arrangement of local haplotypes by similarity. When a rightmost branch is purple, it means that all haplotypes in that branch are identical, at least within the range of variants used in clustering.

Methods

The genomes of 2,504 individuals were sequenced using both whole-genome sequencing (mean depth = 7.4x) and targeted exome sequencing (mean depth = 65.7x). Quoting the Phase 3 publication (1000 Genomes Project Consortium, 2015):

In contrast to earlier phases of the project, we expanded analysis beyond bi-allelic events to include multi-allelic SNPs, indels, and a diverse set of structural variants (SVs). An overview of the sample collection, data generation, data processing, and analysis is given in Extended Data Fig. 1. Variant discovery used an ensemble of 24 sequence analysis tools (Supplementary Table 2), and machine-learning classifiers to separate high-quality variants from potential false positives, balancing sensitivity and specificity. Construction of haplotypes started with estimation of long-range phased haplotypes using array genotypes for project participants and, where available, their first degree relatives; continued with the addition of high confidence bi-allelic variants that were analysed jointly to improve these haplotypes; and concluded with the placement of multi-allelic and structural variants onto the haplotype scaffold one at a time.
See also:

Credits

Thanks to the 1000 Genomes Project for making these data freely available.

References

1000 Genomes Project Consortium, Auton A, Brooks LD, Durbin RM, Garrison EP, Kang HM, Korbel JO, Marchini JL, McCarthy S, McVean GA et al. A global reference for human genetic variation. Nature. 2015 Oct 1;526(7571):68-74. PMID: 26432245