Multiz Alignments of 7 Yeasts
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 1 in window, 640540 - 642504, 1965 bps 
B D  S. cerevisiae  atgctacagatcaactccaggcttgcagttattgatggatggctggtagacactgtgaagcgaaaaccaa
            sacPar  atgctagagatgaatgccaggcttgcagttattgatggatggctagtagatgttgtgaaacgaaagccaa
            sacMik  atgctagagatcaatgctaggtttgtagtcattgatggatggctaatagacgttgtgaagcgaagaccag
            sacKud  atgctagagatcaattctcggttcgcagttatcgatggatggctggtagatgtcctaaagcgaaagccca
            sacBay  atgctagaaatcaattctaaattcgtggtcattgatgggtggctagtggacgttgtagagcgaaaaccaa

     S. cerevisiae  taaattttcggagtcctgaagtaagattactgttacccaatgacgatgactacaaaaagctatcacaaca
            sacPar  tcaatttttggagtcccgaaataagattactattaccgaatgacgatgactacaaaaagttatcacaaca
            sacMik  tcaatttttggagtccggatataagattactattaccgaatgacgacgactacgaaaaactattacagca
            sacKud  tcaatttttggtgtcccgaaataaggttgctattaccgaatgacaacgactatgagaagttattacggca
            sacBay  tcaatttctggagtcctgagataaggttgctaataccgaatgatgacgactatgaaaaactactacagca

     S. cerevisiae  aaacttggtggactggacgcgattaaagaaggattctaattcggtgctcgttggagtgaaatctatggaa
            sacPar  aaatttggtagattggacgagactaaagaaggattctaattcagtacttgttggagtgagatctatagaa
            sacMik  agatttagtaaactgggaacaactaaagaaagactctaaatctgtgctcattggtgtgaagtctatggaa
            sacKud  aaatttgcttgactggacacaattgaaaaaggattctacatcaattctcgtaggagtgtattctgcagaa
            sacBay  agacttggtggattggacacaattaaagaaggatgccaagtccattcttgtaggggtggattcagtggag

     S. cerevisiae  ctatttaaacacataaagctagttttgcgagagtttttcttgttagaagatggaagaataattctgaaga
            sacPar  ctattcaaacacataaatctagttttgcgagagtttttcctgttagaagatggaagaataatcctgaaga
            sacMik  ttatttaagaatataaagctggttcttcgagagtttttcctgttagaagacggaagaatagtcctaaaga
            sacKud  ttattcaaacacataaggctagttttgcgagagtttttcctattggaagatggaaggatagtcctaaaga
            sacBay  ttatttaaacatctaaaattaagcttgcgagagttttttcttctggacgatgggaaagtagtcctcaaaa

     S. cerevisiae  ggatcagaagcaaattacgttacaaagttgtcaagaaattaacttgtaaatgctgcaggttatatttacc
            sacPar  gaatcagaggtaaattacattacaaagtgattaagacattcgcttgtagatgctgcaggttatatttgcc
            sacMik  gaatcaaaagtaaattacattacaaagtgattaaaaagttcgcttgtagatgttgccggttatatttgcc
            sacKud  gaatgaggaataaattgcattacaaagtggttaaaacgttcgctcgtaaatgttgcaggctatttttgcc
            sacBay  ggatccggagcaaactccattgcaaagtgattaaaaagtttgctcagagatgctgtaggttatttttgcc

     S. cerevisiae  aaaatggggcaccgtgtacatacatccgatgctaaaagataaagaaaagcccttagcgggggtatgtgaa
            sacPar  aaaatggggcaccgtgtacatacatccgatgctaaaagataaagaagtgtccttagctggggtatgtgag
            sacMik  aaaatggggaaccatgtacatatatccgatgtcaagcgataagaagtctcgcttaaaaggagtttgtcag
            sacKud  aaaatggggcaccatatatatatatccgttgttacaagataaccaagtttgttcagatggagttcgccag
            sacBay  aaaatggggtacgatttatatctatccaatgattcaagatgaccagatccggccagatggagttcttcag

     S. cerevisiae  ttttcattggatgtaaaccctgatcgggagtatccccttattgagatcaatgttagtcatcaatacatta
            sacPar  ttttcgttggacgttgaccccgatcgggagtatccactaattaacatcaatgtcaatcaccagtacatta
            sacMik  ttttcattgaatgtcgaacctgatcgggagtatccactaatcgacattaatgtcagtcatcagtacatta
            sacKud  tttgcgttggatgtcgagcctaatttggagtatccactaatcgacatcgatttcaattaccagtacacta
            sacBay  ttttctttagacgttcagcctaatttagagtatccgctaattgacataaacgtcaataaccagtacatta

     S. cerevisiae  taattgagggcttccttctatacttaaatgaaaggaggctctataggtggaacgataacaatttgaggag
            sacPar  taatcgagggcttccttctatacttgaatgaaatgaagctctgtaagtgggacgataacaatttaagagc
            sacMik  taatcgaagaatttctattatatttgaacgagaggaggctttacaagtggagcgataactacttaagaga
            sacKud  taattgagggatttctcctatacctaaatgaaaggcgaccttgcaagtggaacgataatgacttgagaaa
            sacBay  taatcgagggcttcctcatatacttaaatgaaaggagactttgtaagtggaacgataacaacttgaggga

     S. cerevisiae  tcaggttggcttaacaaaatgggcccatttaagaaaaacttacaatccggtaagccttgacatactttat
            sacPar  acagattggcttagcggggtggacctatttgagaaggttttacaatccggtgagcctagacatactttac
            sacMik  tcaaatcggtttaagaaagtggtcgcgtttgagaagactttacaatccggtgagcctcgacatacttgac
            sacKud  tcggattggtttaaaagcatgggctagcttgaaaaagctttacaatccaatgagcctcgacatagtttac
            sacBay  tcggataggtttaaaaacatggacatgtttgagaaagctttacaatccaatgagcctcgacatagtttac

     S. cerevisiae  agtttgaattcaaatttttattttgtaaaggatgatctgctatttcaattattaggaaagagggtatttg
            sacPar  agtttaaactcaaattattattttgtgaaagatgatcagctatttcaattattaggaaagaggatttttg
            sacMik  ggtttgaaatcgaattattattttgtgaaggatgatctgctatttcaactattaggaaaaagggttttcg
            sacKud  aatttggactcaaactattactttgtgaaggacgatcggttcttccaactgttgggtagaagagtttttg
            sacBay  aacttgaactcgaattattattttgtgaaagatgatcagttctttcaaataatggggaagcgggcctttg

     S. cerevisiae  ttaaattttgtaaagtaatggaaaatggaaaatgcggtaaggctccactgtggtatcgtgtgaagagaac
            sacPar  ttaaattttgtaaagtaatggaaaacggaaaggacggtaaagcccctgtgtggtactgtgc---gaggac
            sacMik  ttaaattttgcaaaataatgagaaatgaaagggaaggcaaaattccattctggtactgtgc---gaggac
            sacKud  taaaattttgcgaagtaatgaagaataaaacgaatggcaatggcccatctttttattgtgc---aaggac
            sacBay  taaagttctgcaaaacggtaggaaacaacacacacgataaggcctcgttctatttttgtgt---aagaac

     S. cerevisiae  gacaactgccaaagcaacacatattgcatatgccatatcaaattcaacagccccagattcattcaaaagt
            sacPar  aacaactgcaaaagctacacatatagggtatgtcttgccaaatacagcaacactagactccctcaaaaat
            sacMik  gacgacagcgaaagcttcacatattgcatatgttttgccagatacagcaacatctaattctcccacagat
            sacKud  aaccaccgcaaaagctacacatattgcatatgttttgacagatacaaca---cttaatcaccatacggtt
            sacBay  aactaccacgagggctacacatattgcatatattttaacagacgcggca---cgaacttccttcactaat

     S. cerevisiae  aaaaataacgattataggtttattgtcagggaaaagccaattgtggagaatactatctccaacctggatt
            sacPar  aagaaaaatgcttttaggtttattgttagagaaaacccgatcgttgacgataaaacctccaacctgacct
            sacMik  aaaaagagtgttgttagatttattgttagagaacaacctgtcgtagaggatatagtctctaacccgacct
            sacKud  aggaagaacgtttacaggttcattgttagagaacgaccaattgtagagagtatcacttctaccttgaacc
            sacBay  aaaagagatgctttaaaattcattgtcagagaacggccaatcatggaggatgtagattctaacgtgaact

     S. cerevisiae  attcagacataaaaaaacagcagtttactgaagcagaggttgtaaaaagaaagatctcagcagatatttc
            sacPar  atccggatataagaaaacagctgtttactgaagtagaggttgtaaagagagaaatctcatcatatatttc
            sacMik  attcagatttagcagaacagctgtttattgaagtagaggccgtaaaaaagaaaatatcagctaaccttct
            sacKud  cttctgaattaaaaaaacagttgtttaccgaagtaaatgttataaaaaatgccttctcaacctatatctc
            sacBay  tttcagaattgaaaaaccaactttttattgaagtgaagattatcaaaaattttttttcaacttacatttt

     S. cerevisiae  tcaaatagagaatgtgcatacgcaatttaatagtcaaaaggaaaaaaataatatcagggtgaataaggtt
            sacPar  tcaaatagaaaatcagctcacgcaacataatgaccaagaggaaaaaaataacatcagagtgagtaaggtt
            sacMik  tcggttagaaaatcaactaatggaatgtactgatc---aggaaaaaaatgttgtcaaagtaagtaagatt
            sacKud  tcaattagaaaaccaactcatccaatatgttggtcaagcaggggggagtaatatcagaacggacgaagtt
            sacBay  tcaattagaaagccagcttatgaaatatattaatcaagaggagaaaaataattacagggtcggcacgata

     S. cerevisiae  tctagcgaggtcctagatcaaatttcgaaatttcctgtgtccagagtcaccttactgttgatgtctgctg
            sacPar  tctggagaaatactagatcaaattcctaattttcctgtatccaaagtcgccttgttgttgatttctgctg
            sacMik  tctagcgaagtgctggatcaaattcctgactttcctgtatccaaagtcaccttgttattgattgccgctg
            sacKud  tctggcgaggtccttgatcaaattcccaagtttcctgcgtctaaagtcactttgtcgctgattgcggccg
            sacBay  tccggtgaagttcttgatcagattcgtgactttcctgtatcgaaagttactatgtcattgattgccgccg

     S. cerevisiae  gtcaagataaaaattatattgaacttgttgaagaattggcaagaaggttggaaaaaatatgcatagaaaa
            sacPar  gtgaggatagaagttatattgaactagttgaggagttagcaagaagattggaaaaaatgaccatagaaaa
            sacMik  gtgaggataaaaaatacattgaactggttgaagaattagcaagaagactggaaaaaatatgcattgaaaa
            sacKud  gtgaagatagaagatatattgagctacttcaggaattagcaaacaggttggaaaaaatatgcgtggaaga
            sacBay  gtgaagatagaaaatatattgaacttctccaagaattagcaagaaggttggaaaaaatatgcatgaaaaa

     S. cerevisiae  aaccacacaatctttagaagagataagggatacttttcaggcgaatcctgagatgcaggctagctttgat
            sacPar  aaccacacaatctctagaggatgtaagagatacttttcaggcaaattctgagatgcaagccaagtttgat
            sacMik  aaccacacaatctttagaaaatataagaaacacttttctgtcgaaccctggaatacgagctaggtttgat
            sacKud  ggcctcgcaatccttgggaagtattagagctacttttgatccgaatcctgaaatgcgagccagatttgat
            sacBay  gacgttacgctcattggaggagataagagagacttttgatcagaaatctgatttgcaaatcgcactcgaa

     S. cerevisiae  aaggaatattaccagagcattgaagaatataaaattacactcgaacttattaaggaagaccttttgatta
            sacPar  aaggagtattatcagagcatcgaagaatacaaattcactctcgaacttattaaagaagaccttttgatcg
            sacMik  aaggagtattataagagcacagaagaatataaagttacactccaacttattaaagaagactttctgcttc
            sacKud  gaagaatatcgtcaaagcattgctgaatataaaagaacactcaaacttatcaaagaggatcttctgcttg
            sacBay  atggagtattaccaaagcattgaagactgtgaaagaaccctcgaacttatcaaagaagacgtcttgcccc

     S. cerevisiae  ctctgataaaacaaatggaaaatatgtgggcagctg-aaaaaaagtttagtacagaggaggagtatgttt
            sacPar  tactagtaaaacaactaaaaaatatacgggtccctg-aggaagggt---ggaagaaagaagagtatgttt
            sacMik  tattagtaaaacagttaaaaaacacacaggtgtctg-aaacagagt---ttaccagagaagagtatattt
            sacKud  tattagtaaagcagcttggtaataaaatggtacccgtagaaaggat---tcacgagagaagagtatgttt
            sacBay  tattagtgaagcagctagttagtaaatcggtatatg-agtacggct---tggtacaagaagagtatattt

     S. cerevisiae  cgccgaggtttttagtagcagatggatttctaatcgacctagcagaggaaaaaccgattaacccaaagga
            sacPar  ctccgaggttcttagtagcggatggatttttaatcgatctggcggaagaaaacccaattaatccaaagga
            sacMik  cgcccaggttcttagtagcagatggatttttaattgacctggcagaggaaaaactagttgatccaaagga
            sacKud  cgcccaggtttctagtagctgatggatttttaatcgatctggcagaggaaaagccaattgacccaaagga
            sacBay  cgcccaggtttttggcagcagatggatttttgatcgatttggcagaagagaagccaataaacccaaggga

     S. cerevisiae  tccgcgcttactgacactgctaaaagatcatcagcgtgccatgattgaccaaatgaatttagttaagtgg
            sacPar  cccccgtttattgacactgcttaaagattaccagcgtgacatgatttcccaaacgaacctggttgagtgg
            sacMik  cccgcgtctacggacgctattgaaagatcaccagcgcgacattattgcccaaatgaacttgattgcttgg
            sacKud  cccgcgtttgctgacgctcttaaaagattatcaagctgacattgttgcccaaatgaagcttatcatttgg
            sacBay  tcctcgtctgctgacgctgctaaaagattttcagcgcgatagtgttgcccaactcaacttgattgattgg

     S. cerevisiae  aatgacttcaaaaaatatcaagatcctatcccgctgaaagccaaaaccttatttaaattttgtaaacaaa
            sacPar  aatgacctcaaaaaatgtcaggatcccatcccactgcaagctaaatccttatttaaattttgtaaacaaa
            sacMik  gatgacctcaaagaatatcggcatccgatcccattgcaagctaaatctttatttaaactttgcaagcata
            sacKud  gatgacttcaaaaagttacaggatccgatcccgttgcaagctaaaaccgtatttaaactttgtaaacaaa
            sacBay  gatgactttaaaaagtcccaaagcccaattccattacgagctcgaacgttgtttaaatattgcaggaaac

     S. cerevisiae  taaagaaaaaattcctacgaggtgcggacttcaagttacatacattacctacagaagcaaatttaaagta
            sacPar  taaagaaaaaatttctacgagatgcggacttcaagctacatgtactacctacagaagcaaatttgacgga
            sacMik  caaaaaagaacttcatacgagatgcaaacttcaaattacacttattacccactgaggaaaatttgacaag
            sacKud  taaaaaagaaattcctacaagatgcggacttcagactacacacactacctccaggggaaaaaacaactga
            sacBay  tgaataaaatgtttacacaagatgcggattttaaattacacctgccgccctcggaagtaaacatgatgga

     S. cerevisiae  tgagccggagcggatgacagttttgtgttcctgtgtccctattcttttggatgaccaaactgtccaatat
            sacPar  t------gggcgaatgacagttctgtgttcctgcgttcctattcgtttcgatgataacactgtccgatat
            sacMik  c------gcacaaatgtcagttttctatccttgcatccctatttatctggatgacaacactgtccaatac
            sacKud  t------gtacgaatgacaatccggtatccttgtattcccatccgcttggatgaaaacaccgttaaatac
            sacBay  t------gcacagctaatgatttcatatccctgcattcccatatgtttggaggacaaaaaagttcggtat

     S. cerevisiae  ctgtatgatgacagcattattcctgaatttgaa------gcaacatcttcatatgcaacaaagcagtcaa
            sacPar  ctgtatgatgacagcattattcctgaatttgaa------acaacaccgccatatgcaccaaaacagtcac
            sacMik  ctgtacgatgatagcgttatccctgaatatgaa------acgaattcattaaatgctgccatgaaatcaa
            sacKud  ctgtatgatgacagcattattccaggatctgag------aagacatcattatctaaaacacttcaatcaa
            sacBay  ctgtatgacgatagctttattcctgggtgtggaaccgctacaacatcttcgtctgcaacacttcaattaa

     S. cerevisiae  ---agtgtgggcggaaaatgtctttgcaaatggagcctgacctcctttttcaagaggccattagacggat
            sacPar  ---atcgtacatggagagagtgtttgcaaaaggaccctgagctcgttttccaggaggcccttaagcgcat
            sacMik  ---agtgctcgtggagagattctttagagaaggaccctgagtcacttttccaagaggccatcaggcgcat
            sacKud  ---attatcaatggggggagcaacagcagaaagaccccgagttactctttcaagaggccgttaagcgcat
            sacBay  atgattgcgaatggaagaatcgtctacagaaagaccctgaactacaattacaagaaggcgttaagcgtat

     S. cerevisiae  gcgacatttaactgcttatgacgttttgagaagaaactatattgcggcatttgaggagctatatatggga
            sacPar  gcgacttttaacagcttacgaagaattgagaagaaactatattgcggcgttcgaggaactaagtacggca
            sacMik  gcgattcttaatatcttacgaagaattgaaaataaattatatggcagcgtttgaggagttacgcagggga
            sacKud  gcgccttttaacaacttacgaagaatcgagggcaagatatattgctgcttttgaaaaactgcgcacagaa
            sacBay  gcgacttttaacatcttacgaagaattgagatcgaaatacatttttgcttttgaaaaactacgcactgat

     S. cerevisiae  aactgtaacgattaa
            sacPar  aattacaatgactag
            sacMik  aatcacaacgactag
            sacKud  aattatgggaactaa
            sacBay  gagtacggcgactaa

View table schema

Go to Conservation track controls

Data last updated at UCSC: 2011-09-01

Description

This track shows a measure of evolutionary conservation in seven species of the genus Saccharomyces based on a phylogenetic hidden Markov model (phastCons). The graphic display shows the alignment projected onto S. cerevisiae.

The genomes were downloaded from:

Display Conventions and Configuration

In full and pack display modes, conservation scores are displayed as a wiggle track (histogram) in which the height reflects the size of the score. The conservation wiggles can be configured in a variety of ways to highlight different aspects of the displayed information. Click the Graph configuration help link for an explanation of the configuration options.

Pairwise alignments of each species to the S. cerevisiae genome are displayed below the conservation histogram as a grayscale density plot (in pack mode) or as a wiggle (in full mode) that indicates alignment quality. In dense display mode, conservation is shown in grayscale using darker values to indicate higher levels of overall conservation as scored by phastCons.

Checkboxes on the track configuration page allow selection of the species to include in the pairwise display. Configuration buttons are available to select all of the species (Set all), deselect all of the species (Clear all), or use the default settings (Set defaults). Note that excluding species from the pairwise display does not alter the the conservation score display.

To view detailed information about the alignments at a specific position, zoom the display in to 30,000 bases or fewer, then click on the alignment.

Gap Annotation

The Display chains between alignments configuration option enables display of gaps between alignment blocks in the pairwise alignments in a manner similar to the Chain track display. The following conventions are used:

  • Single line: No bases in the aligned species. Possibly due to a lineage-specific insertion between the aligned blocks in the S. cerevisiae genome or a lineage-specific deletion between the aligned blocks in the aligning species.
  • Double line: Aligning species has one or more unalignable bases in the gap region. Possibly due to excessive evolutionary distance between species or independent indels in the region between the aligned blocks in both species.
  • Pale yellow coloring: Aligning species has Ns in the gap region. Reflects uncertainty in the relationship between the DNA of both species, due to lack of sequence in relevant portions of the aligning species.

Downloads for data in this track are available:

Base Level

When zoomed-in to the base-level display, the track shows the base composition of each alignment. The numbers and symbols on the Gaps line indicate the lengths of gaps in the S. cerevisiae sequence at those alignment positions relative to the longest non-S. cerevisiae sequence. If there is sufficient space in the display, the size of the gap is shown. If the space is insufficient and the gap size is a multiple of 3, a "*" is displayed; other gap sizes are indicated by "+".

Codon translation is available in base-level display mode if the displayed region is identified as a coding segment. To display this annotation, select the species for translation from the pull-down menu in the Codon Translation configuration section at the top of the page. Then, select one of the following modes:

  • No codon translation: The gene annotation is not used; the bases are displayed without translation.
  • Use default species reading frames for translation: The annotations from the genome displayed in the Default species to establish reading frame pull-down menu are used to translate all the aligned species present in the alignment.
  • Use reading frames for species if available, otherwise no translation: Codon translation is performed only for those species where the region is annotated as protein coding.
  • Use reading frames for species if available, otherwise use default species: Codon translation is done on those species that are annotated as being protein coding over the aligned region using species-specific annotation; the remaining species are translated using the default species annotation.

Codon translation uses the following gene tracks as the basis for translation, depending on the species chosen (Table 2). Species listed in the row labeled "None" do not have species-specific reading frames for gene translation.

Gene TrackSpecies
SGD GenesS. cerevisae
No annotationall the other yeast strains
Table 2. Gene tracks used for codon translation.

Methods

Best-in-genome pairwise alignments were generated for each species using lastz, followed by chaining and netting. The pairwise alignments were then multiply aligned using multiz, and the resulting multiple alignments were assigned conservation scores by phastCons.

The phastCons program computes conservation scores based on a phylo-HMM, a type of probabilistic model that describes both the process of DNA substitution at each site in a genome and the way this process changes from one site to the next (Felsenstein and Churchill 1996, Yang 1995, Siepel and Haussler 2005). PhastCons uses a two-state phylo-HMM, with a state for conserved regions and a state for non-conserved regions. The value plotted at each site is the posterior probability that the corresponding alignment column was "generated" by the conserved state of the phylo-HMM. These scores reflect the phylogeny (including branch lengths) of the species in question, a continuous-time Markov model of the nucleotide substitution process, and a tendency for conservation levels to be autocorrelated along the genome (i.e., to be similar at adjacent sites). The general reversible (REV) substitution model was used. Note that, unlike many conservation-scoring programs, phastCons does not rely on a sliding window of fixed size, so short highly-conserved regions and long moderately conserved regions can both obtain high scores. More information about phastCons can be found in Siepel et al. (2005).

PhastCons currently treats alignment gaps as missing data, which sometimes has the effect of producing undesirably high conservation scores in gappy regions of the alignment. We are looking at several possible ways of improving the handling of alignment gaps.

Credits

This track was created at UCSC using the following programs:

  • Lastz (formerly Blastz) and multiz by Minmei Hou, Scott Schwartz and Webb Miller of the Penn State Bioinformatics Group.
  • AxtBest, axtChain, chainNet, netSyntenic, and netClass by Jim Kent at UCSC.
  • PhastCons by Adam Siepel at Cornell University.
  • "Wiggle track" plotting software by Hiram Clawson at UCSC.

The phylogenetic tree is based on the Saccharomyces Phylogeny page from the Department of Genetics at Washington University in St. Louis.

References

Phylo-HMMs and phastCons:

Felsenstein J, Churchill GA. A Hidden Markov Model approach to variation among sites in rate of evolution. Mol Biol Evol. 1996 Jan;13(1):93-104. PMID: 8583911

Siepel A, Bejerano G, Pedersen JS, Hinrichs AS, Hou M, Rosenbloom K, Clawson H, Spieth J, Hillier LW, Richards S, et al. Evolutionarily conserved elements in vertebrate, insect, worm, and yeast genomes. Genome Res. 2005 Aug;15(8):1034-50. PMID: 16024819; PMC: PMC1182216

Siepel A, Haussler D. Phylogenetic Hidden Markov Models. In: Nielsen R, editor. Statistical Methods in Molecular Evolution. New York: Springer; 2005. pp. 325-351.

Yang Z. A space-time process model for the evolution of DNA sequences. Genetics. 1995 Feb;139(2):993-1005. PMID: 7713447; PMC: PMC1206396

Chain/Net:

Kent WJ, Baertsch R, Hinrichs A, Miller W, Haussler D. Evolution's cauldron: duplication, deletion, and rearrangement in the mouse and human genomes. Proc Natl Acad Sci U S A. 2003 Sep 30;100(20):11484-9. PMID: 14500911; PMC: PMC208784

Multiz:

Blanchette M, Kent WJ, Riemer C, Elnitski L, Smit AF, Roskin KM, Baertsch R, Rosenbloom K, Clawson H, Green ED, et al. Aligning multiple genomic sequences with the threaded blockset aligner. Genome Res. 2004 Apr;14(4):708-15. PMID: 15060014; PMC: PMC383317

Lastz (formerly Blastz):

Chiaromonte F, Yap VB, Miller W. Scoring pairwise genomic sequence alignments. Pac Symp Biocomput. 2002:115-26. PMID: 11928468

Harris RS. Improved pairwise alignment of genomic DNA. Ph.D. Thesis. Pennsylvania State University, USA. 2007.