Multiz Alignments of 60 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 516 in window, 115930201 - 115930245, 45 bps 
B D            Mouse  tcagagcc----------taggag-----atggctagtgtcc-----------ccgcgga--------ga
B D              Rat  ttagagcc----------taggag-----atgggcaaagtcc-----------ccgagga--------ga
B D   Naked mole-rat  ccaggggc----------tgtgct-----gggcttggggccc-----------atcctga--------gc
B D           Rabbit  ctgcagtc----------t-ggag-----acgcgcaaaagcc-----------ctg-tga--------gc
B D            Human  ttacaggc----------agggag-----acgggcacaaaac-----------acaaata--------aa
B D            Chimp  ttacaggc----------agggag-----acgggcacaaaac-----------acaaata--------aa
B D          Gorilla  ttacaggc----------agggag-----acgggcacaaaac-----------acaaata--------aa
B D        Orangutan  ttacaggc----------agggag-----acgggcacaaaac-----------acaaata--------aa
B D           Gibbon  ttacaggc----------agggag-----acgggcacaaaac-----------acaaata--------aa
B D           Rhesus  ttacaggc----------agggag-----acgagcacgaaac-----------acaaata--------aa
B D           Baboon  ttacaggc----------agggag-----acgagcacgaaac-----------acaaata--------aa
B D         Marmoset  ttgcaggc----------agggag-----accggcacaaaac-----------tcatgcacagaacacaa
B D  Squirrel monkey  ttacaggc----------agggag-----acctgcacaaaac-----------tcacgaacagaacacaa
B D          Tarsier  ttacagcc----------tgagag-----atggataaaagccgtgcgaacaggacaaata--------aa
B D      Mouse lemur  ccccgggg----ctcccctgggac-----atggacataaaac-----------acagg----------aa
B D         Bushbaby  tgcagagaaaactgttcgtgaggctgttactacacgccaggc-----------accat----------gc
B D          Dolphin  ttacagcc----------taggag-----atggacaaaagac-----------acatgaa--------ca
B D            Sheep  gtacagcc----------taag----------------agac-----------ccatgaa--------ca
B D              Cow  ttacagcc----------tagg----------------agac-----------ccatgaa--------ca
B D              Cat  tgccagcc----------tgtgag-----ttggacaaaaaac-----------atgtgaa--------ca
B D              Dog  tgacagcc----------tgtgag-----atggacagaaaac-----------acgtgaa--------ca
B D            Panda  tgacagcc----------tgtgag-----atggacaaaaaac-----------acatgaa--------ca
B D            Horse  ttacagcc----------tgggag-----atggacaaaaacc-----------atgtgaa--------ca
B D         Microbat  tgacagcc----------tgggag-----atggaccaaaagc-----------acatgaa--------ca
B D          Megabat  ttatagcc----------tgggag-----atggaccaagaac-----------acatgca--------ca
B D              Pig  ======================================================================
B D         Squirrel  ======================================================================
B D          Manatee  ======================================================================
B D         Elephant  ======================================================================
B D       Guinea pig  ======================================================================
B D     Nile tilapia  ======================================================================
B D             Fugu  ======================================================================
B D     Atlantic cod  ======================================================================
B D           Medaka  ======================================================================
B D             Pika  ======================================================================
B D        Armadillo  ======================================================================
B D       Budgerigar  ======================================================================
B D      Zebra finch  ======================================================================
B D           Lizard  ======================================================================
B D   Painted turtle  ======================================================================
B D          Chicken  ======================================================================
B D           Turkey  ======================================================================
B D            Shrew  ======================================================================
B D       Rock hyrax  ======================================================================
B D           Tenrec  ======================================================================
B D           Alpaca  ======================================================================
B D          Wallaby  ======================================================================
B D     Kangaroo rat  ======================================================================
B D       Coelacanth  ======================================================================
B D    X. tropicalis  ======================================================================
B D         Platypus  ======================================================================
B D  Tasmanian devil  ======================================================================
B D          Opossum  ======================================================================

               Mouse  ccacgatga
                 Rat  ccataatga
      Naked mole-rat  caccagcca
              Rabbit  agacaaagg
               Human  aagcttcca
               Chimp  aagcttcca
             Gorilla  aagcttcca
           Orangutan  aagcttcca
              Gibbon  aagcttcca
              Rhesus  aagcctccg
              Baboon  aagcttccg
            Marmoset  aaggcttca
     Squirrel monkey  aaggcttca
             Tarsier  aa--ttcca
         Mouse lemur  cagaatgca
            Bushbaby  tgggctcca
             Dolphin  gaataggaa
               Sheep  gaataggaa
                 Cow  gaataggaa
                 Cat  gagcataaa
                 Dog  gaacat---
               Panda  gaacataaa
               Horse  gaacatgaa
            Microbat  gaacatgaa
             Megabat  gaacatgaa
                 Pig  =========
            Squirrel  =========
             Manatee  =========
            Elephant  =========
          Guinea pig  =========
        Nile tilapia  =========
                Fugu  =========
        Atlantic cod  =========
              Medaka  =========
                Pika  =========
           Armadillo  =========
          Budgerigar  =========
         Zebra finch  =========
              Lizard  =========
      Painted turtle  =========
             Chicken  =========
              Turkey  =========
               Shrew  =========
          Rock hyrax  =========
              Tenrec  =========
              Alpaca  =========
             Wallaby  =========
        Kangaroo rat  =========
          Coelacanth  =========
       X. tropicalis  =========
            Platypus  =========
     Tasmanian devil  =========
             Opossum  =========

Inserts between block 1 and 2 in window
B D         Dolphin 5bp
B D           Sheep 5bp
B D             Cow 5bp
B D             Cat 5bp
B D             Dog 3bp
B D           Panda 5bp
B D           Horse 5bp
B D        Microbat 5bp
B D         Megabat 5bp

Alignment block 2 of 516 in window, 115930246 - 115930269, 24 bps 
B D            Mouse  --------agc-----------------------ttcc-------------------------cagctgt
B D              Rat  --------tgt-----------------------ttc---------------------------------
B D   Naked mole-rat  --------ggc-----------------------cgct-------------------------gggagct
B D           Rabbit  --------gac-----------------------------------------------------------
B D            Human  --------tgc-----------------------tgtc-------------------------agaagca
B D            Chimp  --------tgc-----------------------tgtc-------------------------agaagca
B D          Gorilla  --------tgc-----------------------tgtc-------------------------agaagca
B D        Orangutan  --------tgc-----------------------tgtc-------------------------agaagca
B D           Gibbon  --------tgc-----------------------tgtc-------------------------agaagca
B D           Rhesus  --------tgc-----------------------tgcc-------------------------agaagca
B D           Baboon  --------tgc-----------------------tgcc-------------------------agaagca
B D         Marmoset  --------tgc-----------------------tgtc-------------------------agaagca
B D  Squirrel monkey  --------cgc-----------------------tgtc-------------------------agaagca
B D          Tarsier  --------agc-----------------------tgtc-------------------------a-cagca
B D      Mouse lemur  --------gac-------------------agctcccc-------------------------agcagtc
B D         Bushbaby  --------gactgacccaggaccccttgggggctcacctgggagatgagcacaaaacagtgatggcagca
B D              Pig  agcttccaagc-----------------------tgtc-------------------------atgagca
B D          Dolphin  agcttccagat-----------------------tgtc-------------------------ataagca
B D            Sheep  agcttccaggt-----------------------tgtc-------------------------ataagcg
B D              Cow  agcttccacgt-----------------------tgtc-------------------------agaagcg
B D              Cat  agcttccaagc-----------------------tgtc-------------------------ac-agcg
B D              Dog  agcttccaggc-----------------------tgtc-------------------------agaagtg
B D            Panda  agcttccaggc-----------------------tgtc-------------------------ttaagcg
B D            Horse  agcttccaggc-----------------------tgtc-------------------------ataagca
B D         Microbat  agcttccaggc-----------------------tgtc-------------------------ataagca
B D          Megabat  agcttccaggc-----------------------tgtc-------------------------ataagca
B D         Squirrel  ======================================================================
B D          Manatee  ======================================================================
B D         Elephant  ======================================================================
B D       Guinea pig  ======================================================================
B D     Nile tilapia  ======================================================================
B D             Fugu  ======================================================================
B D     Atlantic cod  ======================================================================
B D           Medaka  ======================================================================
B D             Pika  ======================================================================
B D        Armadillo  ======================================================================
B D       Budgerigar  ======================================================================
B D      Zebra finch  ======================================================================
B D           Lizard  ======================================================================
B D   Painted turtle  ======================================================================
B D          Chicken  ======================================================================
B D           Turkey  ======================================================================
B D            Shrew  ======================================================================
B D       Rock hyrax  ======================================================================
B D           Tenrec  ======================================================================
B D           Alpaca  ======================================================================
B D          Wallaby  ======================================================================
B D     Kangaroo rat  ======================================================================
B D       Coelacanth  ======================================================================
B D    X. tropicalis  ======================================================================
B D         Platypus  ======================================================================
B D  Tasmanian devil  ======================================================================
B D          Opossum  ======================================================================

               Mouse  ct---caa-gcac--a
                 Rat  -t---caa-gcac--a
      Naked mole-rat  gt---cagcacac--a
              Rabbit  ---------ttgc--a
               Human  ct---atg-caaa--a
               Chimp  ct---atg-caaa--a
             Gorilla  ct---atg-caaa--a
           Orangutan  ct---atg-caaa--a
              Gibbon  ct---atg-caaa--a
              Rhesus  ct---agg-caac--a
              Baboon  ct---agg-caac--a
            Marmoset  cc---agg-caac--a
     Squirrel monkey  cc---agg-caac--a
             Tarsier  ct---aga-tgac--c
         Mouse lemur  -----aag-cggc--a
            Bushbaby  -----gag-cgac--a
                 Pig  ttgggaag-tgac--a
             Dolphin  ctaggagg-taac--a
               Sheep  ttaggggg-taac--a
                 Cow  ttagcggg-taac--a
                 Cat  ttaggagg-aggtgaa
                 Dog  ttaggagg-aggtgaa
               Panda  ttaggagg-aggtgaa
               Horse  ttaggagg-tgac--a
            Microbat  taggaagg--gac--a
             Megabat  aaaggagg-tgac--a
            Squirrel  ================
             Manatee  ================
            Elephant  ================
          Guinea pig  ================
        Nile tilapia  ================
                Fugu  ================
        Atlantic cod  ================
              Medaka  ================
                Pika  ================
           Armadillo  ================
          Budgerigar  ================
         Zebra finch  ================
              Lizard  ================
      Painted turtle  ================
             Chicken  ================
              Turkey  ================
               Shrew  ================
          Rock hyrax  ================
              Tenrec  ================
              Alpaca  ================
             Wallaby  ================
        Kangaroo rat  ================
          Coelacanth  ================
       X. tropicalis  ================
            Platypus  ================
     Tasmanian devil  ================
             Opossum  ================

Alignment block 3 of 516 in window, 115930270 - 115930281, 12 bps 
B D            Mouse  agctggctgcag---
B D              Rat  agctgactgcag---
B D   Naked mole-rat  gcccggggccag---
B D           Rabbit  agctgtcgtgat---
B D            Human  agcaagatgctg---
B D            Chimp  agcaaggtgctg---
B D          Gorilla  agcaaggtgcta---
B D        Orangutan  agcgaggtgctg---
B D           Gibbon  agcaaggtgctg---
B D           Rhesus  agcaaggtgctg---
B D           Baboon  agcaaggtgctg---
B D         Marmoset  ggcaaggcgcca---
B D  Squirrel monkey  agcgaggtgccg---
B D          Tarsier  agcaaggtgcta---
B D      Mouse lemur  ggtg----gctg---
B D         Bushbaby  ggcagggtgctg---
B D              Pig  agcaaggtcctg---
B D          Dolphin  agcaaggtcctg---
B D            Sheep  agcaaggccgtg---
B D              Cow  agcaaggccatg---
B D              Cat  ggcaaggtgctg---
B D              Dog  ggcaaggcactg---
B D            Panda  ggcaacgcattg---
B D            Horse  ggcaaagtgctg---
B D         Microbat  cg-aaggtgctg---
B D          Megabat  agcaaggcactg---
B D          Manatee  ----agctggtgcaa
B D         Squirrel  ===============
B D         Elephant  ===============
B D       Guinea pig  ===============
B D     Nile tilapia  ===============
B D             Fugu  ===============
B D     Atlantic cod  ===============
B D           Medaka  ===============
B D             Pika  ===============
B D        Armadillo  ===============
B D       Budgerigar  ===============
B D      Zebra finch  ===============
B D           Lizard  ===============
B D   Painted turtle  ===============
B D          Chicken  ===============
B D           Turkey  ===============
B D            Shrew  ===============
B D       Rock hyrax  ===============
B D           Tenrec  ===============
B D           Alpaca  ===============
B D          Wallaby  ===============
B D     Kangaroo rat  ===============
B D       Coelacanth  ===============
B D    X. tropicalis  ===============
B D         Platypus  ===============
B D  Tasmanian devil  ===============
B D          Opossum  ===============

Inserts between block 3 and 4 in window
B D  Naked mole-rat 5bp

Alignment block 4 of 516 in window, 115930282 - 115930331, 50 bps 
B D            Mouse  aggctgctgaggcactgc-----tagctggggatggg----------------------ggcaggg----
B D              Rat  aggc---------actgc-----tgagctggggaggg----------------------ggcaggg----
B D   Naked mole-rat  aggc---------agtgcatgagggagctgcaaaagc----------------------accaggc----
B D           Rabbit  gagc---------a---------ggcgccgtgcgagg----------------------ggctggg----
B D            Human  aggt---------actgc-----taagctgtgtggga---tgggggct----cagcccggccaggg----
B D            Chimp  aggt---------actgc-----taagctgtgtggga---tgggggct----cagcccggccaggg----
B D          Gorilla  aggt---------actgc-----taagctgtgtggga---taggggct----cagcccggccaggg----
B D        Orangutan  aggt---------actgc-----taagctgtgtggga---tgggggct----cagcccggccaggg----
B D           Gibbon  aggt---------actgc-----taagctgtgtggga---tgggggct----cagcccggccaggg----
B D           Rhesus  aggt---------actgc-----taagctgtgttggg---tgggggct----cagcccggccaggg----
B D           Baboon  aggt---------actgc-----taagctgtgtaggg---tgggggct----cagcccggccaggg----
B D         Marmoset  aggt---------gctgc-----taagctgtgtaggg---caggggct----cagcccttccaggg----
B D  Squirrel monkey  aggt---------actgc-----taagctgtgtaggg---tgggggct----cagcccggccaggg----
B D          Tarsier  a-at---------actgt-----tgagctgtgcggggggtcaggggct----cagcccatcctgg-----
B D      Mouse lemur  aggt---------gccgc-----tgacc---gtgggg---gcgggg-----------cggccgggc----
B D         Bushbaby  agga---------actgc-----tga---------------------------------gctgtgc----
B D              Pig  aggt-------------------tgaaggttgagggc---tga--gcc----cagctcacatagg-----
B D          Dolphin  aggt-------------------cgagggtcgaggga---tca--gcc----cggcctgggcaggg---c
B D            Sheep  agtt-------------------tgacggtcgggggc---tca--gcc----tggccagagcaggg---c
B D              Cow  agtt-------------------tgagggtcgggggg---aca--gcc----tggccagggcaggg---c
B D              Cat  aggt-------------------ctatgggtgagggc---tca--ccc----cagccagctctggg---c
B D              Dog  aggt-------------------cta-ggattgaggc---tcc--ccc----tggcctacacagggttac
B D            Panda  aggt-------------------cta-ggattggggc---tca--ccc----cggccagcacaggg---c
B D            Horse  agat-------------------cca-ggg----------------ct----cagccagggtggag---c
B D         Microbat  aggt-------------------t-------gagggc---tca--gcc----cagccagggtgggg---c
B D          Megabat  aggt-------------------taaggggcaagggc---tca--gcc----ctgccagggc-ggg---t
B D       Rock hyrax  -------------------------------------------aggct----tggccaaggtgcag---c
B D          Manatee  ----------------------------------ggg---ttggggcttagctggccagggtgggg---c
B D         Squirrel  ======================================================================
B D         Elephant  ======================================================================
B D       Guinea pig  ======================================================================
B D     Nile tilapia  ======================================================================
B D             Fugu  ======================================================================
B D     Atlantic cod  ======================================================================
B D           Medaka  ======================================================================
B D             Pika  ======================================================================
B D        Armadillo  ======================================================================
B D       Budgerigar  ======================================================================
B D      Zebra finch  ======================================================================
B D           Lizard  ======================================================================
B D   Painted turtle  ======================================================================
B D          Chicken  ======================================================================
B D           Turkey  ======================================================================
B D            Shrew  ======================================================================
B D           Tenrec  ======================================================================
B D           Alpaca  ======================================================================
B D          Wallaby  ======================================================================
B D     Kangaroo rat  ======================================================================
B D       Coelacanth  ======================================================================
B D    X. tropicalis  ======================================================================
B D         Platypus  ======================================================================
B D  Tasmanian devil  ======================================================================
B D          Opossum  ======================================================================

               Mouse  -----ta-g--------atctgggg
                 Rat  -----ta-g--------atctgggg
      Naked mole-rat  -----ca-c--------a-ctgagg
              Rabbit  -----tg-g--------g-ctgggc
               Human  -----ag-g--------ggccagtt
               Chimp  -----ag-g--------ggctggtt
             Gorilla  -----ag-g--------ggctggtt
           Orangutan  -----ag-g--------ggccggtt
              Gibbon  -----ag-g--------ggacggtt
              Rhesus  -----ag-g--------ggctgggt
              Baboon  -----ag-g--------ggctgagt
            Marmoset  -----ag-g--------ggccgggt
     Squirrel monkey  -----ag-g--------ggcagggt
             Tarsier  ------g-g--------ggctgctt
         Mouse lemur  -----cg-g--------g-------
            Bushbaby  -----ag-g--------g-------
                 Pig  ---gtgg-a----------ctggtc
             Dolphin  tgtgtgg-g----------ctggtg
               Sheep  tgcgcgt-g----------ctggtc
                 Cow  tgcgtgc-t----------ctggtc
                 Cat  tgtgtgg-g--------ggtcagtc
                 Dog  tgtgtggag--------ggccgctg
               Panda  tgtgtgt-g--------ggctggtc
               Horse  tgtgtgt-t--------ggccactc
            Microbat  tgtatgg-g--------ggctggtt
             Megabat  tgtgtag-ggtccgtctgtctggtt
          Rock hyrax  tggatgt-g--------ggctggtg
             Manatee  tgggtgt-g--------ggccggtg
            Squirrel  =========================
            Elephant  =========================
          Guinea pig  =========================
        Nile tilapia  =========================
                Fugu  =========================
        Atlantic cod  =========================
              Medaka  =========================
                Pika  =========================
           Armadillo  =========================
          Budgerigar  =========================
         Zebra finch  =========================
              Lizard  =========================
      Painted turtle  =========================
             Chicken  =========================
              Turkey  =========================
               Shrew  =========================
              Tenrec  =========================
              Alpaca  =========================
             Wallaby  =========================
        Kangaroo rat  =========================
          Coelacanth  =========================
       X. tropicalis  =========================
            Platypus  =========================
     Tasmanian devil  =========================
             Opossum  =========================

Inserts between block 4 and 5 in window
B D  Naked mole-rat 11bp
B D          Rabbit 12bp
B D           Human 41bp
B D           Chimp 41bp
B D         Gorilla 41bp
B D       Orangutan 41bp
B D          Gibbon 38bp
B D          Rhesus 41bp
B D          Baboon 41bp
B D        Marmoset 41bp
B D Squirrel monkey 41bp
B D         Tarsier 44bp
B D     Mouse lemur 40bp
B D        Bushbaby 37bp
B D             Pig 25bp
B D         Dolphin 33bp
B D           Sheep 33bp
B D             Cow 33bp
B D             Cat 33bp
B D             Dog 25bp
B D           Panda 32bp
B D           Horse 33bp
B D        Microbat 26bp
B D         Megabat 31bp

Alignment block 5 of 516 in window, 115930332 - 115930339, 8 bps 
B D            Mouse  ctgaccac
B D              Rat  gtgaccac
B D     Kangaroo rat  ctgaccac
B D   Naked mole-rat  ctgcctgc
B D           Rabbit  caggccac
B D            Human  ctggccat
B D            Chimp  ctggccat
B D          Gorilla  ctggccat
B D        Orangutan  ctggccat
B D           Gibbon  ctggccat
B D           Rhesus  ctggccat
B D           Baboon  ctggccat
B D         Marmoset  ctggccat
B D  Squirrel monkey  ctggccat
B D          Tarsier  ccggccac
B D      Mouse lemur  ctggccac
B D         Bushbaby  gtagtcac
B D              Pig  ctggctac
B D          Dolphin  ctggctac
B D            Sheep  ctggccag
B D              Cow  ctggccac
B D              Cat  ctggctac
B D              Dog  ctggctac
B D            Panda  ctggcagc
B D            Horse  ctggctac
B D         Microbat  ----ctac
B D          Megabat  ctggctac
B D       Rock hyrax  ctgaccca
B D          Manatee  ttggccag
B D        Armadillo  ctggccac
B D         Squirrel  ========
B D         Elephant  ========
B D       Guinea pig  ========
B D     Nile tilapia  ========
B D             Fugu  ========
B D     Atlantic cod  ========
B D           Medaka  ========
B D             Pika  ========
B D       Budgerigar  ========
B D      Zebra finch  ========
B D           Lizard  ========
B D   Painted turtle  ========
B D          Chicken  ========
B D           Turkey  ========
B D            Shrew  ========
B D           Tenrec  ========
B D           Alpaca  ========
B D          Wallaby  ========
B D       Coelacanth  ========
B D    X. tropicalis  ========
B D         Platypus  ========
B D  Tasmanian devil  ========
B D          Opossum  ========

Inserts between block 5 and 6 in window
B D      Rock hyrax 20bp
B D         Manatee 14bp

Alignment block 6 of 516 in window, 115930340 - 115930342, 3 bps 
B D            Mouse  cag
B D              Rat  cag
B D     Kangaroo rat  ccg
B D   Naked mole-rat  tac
B D           Rabbit  tgg
B D            Human  gag
B D            Chimp  gag
B D          Gorilla  gaa
B D        Orangutan  gag
B D           Gibbon  gag
B D           Rhesus  gag
B D           Baboon  gag
B D         Marmoset  gag
B D  Squirrel monkey  gag
B D          Tarsier  tag
B D      Mouse lemur  c-g
B D         Bushbaby  cag
B D              Pig  cag
B D          Dolphin  caa
B D            Sheep  cag
B D              Cow  cag
B D              Cat  ca-
B D              Dog  ca-
B D            Panda  tg-
B D            Horse  cag
B D         Microbat  cag
B D          Megabat  cag
B D         Elephant  cag
B D       Rock hyrax  cag
B D          Manatee  cag
B D        Armadillo  cag
B D         Squirrel  ===
B D       Guinea pig  ===
B D     Nile tilapia  ===
B D             Fugu  ===
B D     Atlantic cod  ===
B D           Medaka  ===
B D             Pika  ===
B D       Budgerigar  ===
B D      Zebra finch  ===
B D           Lizard  ===
B D   Painted turtle  ===
B D          Chicken  ===
B D           Turkey  ===
B D            Shrew  ===
B D           Tenrec  ===
B D           Alpaca  ===
B D          Wallaby  ===
B D       Coelacanth  ===
B D    X. tropicalis  ===
B D         Platypus  ===
B D  Tasmanian devil  ===
B D          Opossum  ===

Inserts between block 6 and 7 in window
B D  Naked mole-rat 1bp
B D        Microbat 5bp
B D         Megabat 5bp

Alignment block 7 of 516 in window, 115930343 - 115930410, 68 bps 
B D            Mouse  ggtca------gaatcagaacctccaccttgacctcattaacgctggtcttaat-caccaagccaagctc
B D              Rat  ggtcat-gtcagaatcagaacctccaccttgacctcattaacgctggtcttaat-caccaagccaagctc
B D     Kangaroo rat  gctcag-gtcagaatcacactatccaccttgacctcattaacaccag-cctaag-cactgggccaagcat
B D   Naked mole-rat  ggtctgcctcagagccatg--ctccaccttgacctcattaacaca--gcctaat-cgctgggccaagcgc
B D       Guinea pig  ggtctgcgtcagagccaca--ctccaccttgacctcattaacgcagggcctaat-cgctgggccaagcac
B D           Rabbit  --acgctgtcagaatcaaaccttccaccttgacctcattagcttgcagcctaat-cactgggtcaagcgt
B D            Human  ggtccacgtcagaatcaaa-ccctcaccttaacctcattagcgttgggcataat-caccaggccaagcgc
B D            Chimp  ggtccacgtcagaatcaaa-ccctcaccttaacctcattagcgttgggcctaat-caccaggccaagcgc
B D          Gorilla  ggtccacgtcagaatcaaa-ccctcaccttaacctcattagcgttgggcataat-caccaggccaagcgc
B D        Orangutan  ggtccacgtcagaatcaaa-ccctcaccttaacctcattagcgttgggcataat-caccaggccaagcgc
B D           Gibbon  ggtccatgtcagaatcaaa-ccctcaccttaacctcattagcgttgggcataat-caccaggccaagcgc
B D           Rhesus  ggtccacgtcagaatcaaaccccccaccttaacctcattagcgttgggcataat-caccaggccaagcgc
B D           Baboon  ggtccacgtcagaatcaaaccccccaccttaacctcattagcattgggcataat-caccaggccaagcgc
B D         Marmoset  ggtccacatcagaatcaaa-ctcccaccttaacctcattagcgttgggcataat-caccaggccaaacac
B D  Squirrel monkey  ggtccacgtcagaatcaaaccccccaccttaacctcattagtgttgggcataat-caccaggccaagcgc
B D          Tarsier  agcccatggcagaatcaaaccatccaccttgacctcattagcgctgagcctaat-caccaggccaagcgc
B D      Mouse lemur  gggtcacgtcagaatcaaaccctccaccttgacctcattagcgttgggcctaat-cccc--gccaagcgc
B D         Bushbaby  gggccacgtcagaatcaaaccttccaccttgacctcattagcgttgggcctaat-tact--accaagcgc
B D              Pig  ggcctgcatcagaatcaaacccttcaccttgacctcattagccatgggcctaat-cactagg-caagcgc
B D          Dolphin  gggccgcgtcag----aaactcttccccttgacctcattaacaacaggcctaat-cactgggccaagcgc
B D            Sheep  gggccgtgtcagaatcaaactcttcaccttgacctctttagcgatgggcctaat-cactgggccaagcac
B D              Cow  gggccgtgttagaatcaaactcttcaccttgacctctttagcgatggacctaat-cacagggccaag---
B D              Cat  gggccacgtcagaatcaaaccctccaccttgacctcattaacattgggcctaat-cactgaaccaagcac
B D              Dog  gggccacgtcagaatcaaaccctccaccttgacctcattagcgttgggcctaat-cactgagccaggctt
B D            Panda  ggcccacatcagaatcaaaccctccaccttgacctcattagcattgggcctaatcccctgagccaggcac
B D            Horse  gggccacggcagaatcaaaccctccaccttgacctcattagcactaggcctaat-cactgggccaagcgc
B D         Microbat  aggctgtgtcagaatcaaaccctccaccttgacctcattagcgttgggcctaat-cactgggccaagcgc
B D          Megabat  gggctgtgtcagaatcaaaccctccaccttgacctcattagcattgggcctaat--actgggccaagcgc
B D         Elephant  ggtc--tgtgggaatcaaaccctccaccttgacctcattcgcattgggcttaat-cacca-gccaagcgc
B D       Rock hyrax  ggtc--tgtgggaatcaaaccctccaccttgaccttattagcattgagcctaat-cacca-gcctaacgc
B D          Manatee  ggtc--tgtgtgaatcaaactctccaccttgaccttattagtattgggcctaat-cacca-gccaagcgc
B D        Armadillo  ggtccacgtcagaatcaaaccctccaccttgacctcattagcgttgggtctaat-caccctgccaagcgc
B D         Squirrel  ======================================================================
B D     Nile tilapia  ======================================================================
B D             Fugu  ======================================================================
B D     Atlantic cod  ======================================================================
B D           Medaka  ======================================================================
B D             Pika  ======================================================================
B D       Budgerigar  ======================================================================
B D      Zebra finch  ======================================================================
B D           Lizard  ======================================================================
B D   Painted turtle  ======================================================================
B D          Chicken  ======================================================================
B D           Turkey  ======================================================================
B D            Shrew  ======================================================================
B D           Tenrec  ======================================================================
B D           Alpaca  ======================================================================
B D          Wallaby  ======================================================================
B D       Coelacanth  ======================================================================
B D    X. tropicalis  ======================================================================
B D         Platypus  ======================================================================
B D  Tasmanian devil  ======================================================================
B D          Opossum  ======================================================================

               Mouse  ctt-aa
                 Rat  ctttaa
        Kangaroo rat  cttaaa
      Naked mole-rat  cttaa-
          Guinea pig  cataa-
              Rabbit  cttaa-
               Human  cttaa-
               Chimp  cttaa-
             Gorilla  cttaa-
           Orangutan  cttaa-
              Gibbon  cttaa-
              Rhesus  cttaa-
              Baboon  cttaa-
            Marmoset  cttaa-
     Squirrel monkey  cttaa-
             Tarsier  cttac-
         Mouse lemur  cttaa-
            Bushbaby  cttaa-
                 Pig  cttac-
             Dolphin  cttgc-
               Sheep  cttac-
                 Cow  ----c-
                 Cat  cttaa-
                 Dog  cttaa-
               Panda  cttaa-
               Horse  cttaa-
            Microbat  cttaa-
             Megabat  cttaa-
            Elephant  cttaa-
          Rock hyrax  cttaa-
             Manatee  cttaa-
           Armadillo  cttaa-
            Squirrel  ======
        Nile tilapia  ======
                Fugu  ======
        Atlantic cod  ======
              Medaka  ======
                Pika  ======
          Budgerigar  ======
         Zebra finch  ======
              Lizard  ======
      Painted turtle  ======
             Chicken  ======
              Turkey  ======
               Shrew  ======
              Tenrec  ======
              Alpaca  ======
             Wallaby  ======
          Coelacanth  ======
       X. tropicalis  ======
            Platypus  ======
     Tasmanian devil  ======
             Opossum  ======

Inserts between block 7 and 8 in window
B D      Guinea pig 818bp

Alignment block 8 of 516 in window, 115930411 - 115930424, 14 bps 
B D            Mouse  act------------------------------gctagtggcca
B D              Rat  act------------------------------gctggaggcca
B D     Kangaroo rat  actgtgacattcccacataccctgcccagccacgcctcaggctt
B D   Naked mole-rat  --------------------------------cggcagaggcc-
B D           Rabbit  ------------------------------agtgcgagaggctg
B D            Human  ------------------------------actacgagaggccc
B D            Chimp  ------------------------------actacgagaggccc
B D          Gorilla  ------------------------------actacgagaggccc
B D        Orangutan  ------------------------------actacgagaggccc
B D           Gibbon  ------------------------------actacgagaggccc
B D           Rhesus  ------------------------------actacgagaggctc
B D           Baboon  ------------------------------actacgagaggccc
B D         Marmoset  ------------------------------actccaggaggtcc
B D  Squirrel monkey  ------------------------------actgcaagaggccc
B D          Tarsier  ------------------------------acggagagaggcca
B D      Mouse lemur  ------------------------------actgcgagaggccg
B D         Bushbaby  ------------------------------actgtgacaggcta
B D              Pig  ------------------------------ccttcaagt-gcca
B D          Dolphin  ------------------------------actttgagggacca
B D            Sheep  ------------------------------accttgagcagccg
B D              Cow  ------------------------------accttgagcagctg
B D              Cat  ------------------------------actgcgaaaggtca
B D              Dog  ------------------------------acagcgagaggtca
B D            Panda  ------------------------------actgtgagaggtca
B D            Horse  ------------------------------actgcaagaggtcg
B D         Microbat  ------------------------------actacaagaggtca
B D          Megabat  ------------------------------actgcaagaggtca
B D         Elephant  ------------------------------acttcgagaggtca
B D       Rock hyrax  ------------------------------actttgagaggtca
B D          Manatee  ------------------------------acttcgagaggtca
B D        Armadillo  ------------------------------cctgggaggggtcg
B D         Squirrel  ============================================
B D       Guinea pig  ============================================
B D     Nile tilapia  ============================================
B D             Fugu  ============================================
B D     Atlantic cod  ============================================
B D           Medaka  ============================================
B D             Pika  ============================================
B D       Budgerigar  ============================================
B D      Zebra finch  ============================================
B D           Lizard  ============================================
B D   Painted turtle  ============================================
B D          Chicken  ============================================
B D           Turkey  ============================================
B D            Shrew  ============================================
B D           Tenrec  ============================================
B D           Alpaca  ============================================
B D          Wallaby  ============================================
B D       Coelacanth  ============================================
B D    X. tropicalis  ============================================
B D         Platypus  ============================================
B D  Tasmanian devil  ============================================
B D          Opossum  ============================================

Inserts between block 8 and 9 in window
B D           Panda 30bp
B D        Elephant 19bp
B D      Rock hyrax 2542bp
B D         Manatee 20bp
B D       Armadillo 2bp

Alignment block 9 of 516 in window, 115930425 - 115930431, 7 bps 
B D            Mouse  actcc---ca-
B D              Rat  acttc---ca-
B D     Kangaroo rat  acttc---tc-
B D   Naked mole-rat  acctc---ca-
B D           Rabbit  cacct---cg-
B D            Human  catcc---ca-
B D            Chimp  catcc---ca-
B D          Gorilla  catcc---ca-
B D        Orangutan  catcc---ca-
B D           Gibbon  catcc---ca-
B D           Rhesus  catcc---ca-
B D           Baboon  catcc---ca-
B D         Marmoset  catcc---ca-
B D  Squirrel monkey  caccc---ca-
B D          Tarsier  cacccccacc-
B D      Mouse lemur  cgccc---ca-
B D         Bushbaby  caccc---cg-
B D              Pig  cacct---tt-
B D          Dolphin  cgccc---ca-
B D            Sheep  caccc---ca-
B D              Cow  cgccc---ca-
B D              Cat  caccc---ca-
B D              Dog  ccccc---ca-
B D            Horse  caccc---ca-
B D         Microbat  cagcc---ca-
B D          Megabat  caccc---ca-
B D         Elephant  -actc---cac
B D          Manatee  -actc---cac
B D        Armadillo  -accc---cgc
B D         Squirrel  ===========
B D            Panda  ===========
B D       Guinea pig  ===========
B D     Nile tilapia  ===========
B D             Fugu  ===========
B D     Atlantic cod  ===========
B D           Medaka  ===========
B D             Pika  ===========
B D       Budgerigar  ===========
B D      Zebra finch  ===========
B D           Lizard  ===========
B D   Painted turtle  ===========
B D          Chicken  ===========
B D           Turkey  ===========
B D            Shrew  ===========
B D       Rock hyrax  ===========
B D           Tenrec  ===========
B D           Alpaca  ===========
B D          Wallaby  ===========
B D       Coelacanth  ===========
B D    X. tropicalis  ===========
B D         Platypus  ===========
B D  Tasmanian devil  ===========
B D          Opossum  ===========

Inserts between block 9 and 10 in window
B D             Pig 11bp
B D         Dolphin 28bp
B D           Sheep 1649bp
B D             Cow 13bp
B D             Cat 31bp
B D             Dog 40bp
B D           Horse 31bp
B D        Microbat 31bp
B D         Megabat 31bp

Alignment block 10 of 516 in window, 115930432 - 115930462, 31 bps 
B D            Mouse  ggccctg-------acacacata--------cctgccctgtgttc----c
B D              Rat  gcccctg-------acacacaca--------cctgacctgtgttc----c
B D     Kangaroo rat  agccctg-------ccccccacg--------tgtgtccggagggg----t
B D   Naked mole-rat  gcccatg-------gtgctctca-----------gccctctgtgg----c
B D           Rabbit  ccccctg-------ccccgcc-------------accctctgcgc----c
B D            Human  cccgccc-------tgccttagc--------cctgccacgtgtgc----c
B D            Chimp  tccgccc-------tgccttagc--------cctgccatgtgtgc----c
B D          Gorilla  cccgccc-------tgccttagc--------cctgccacatgtgc----c
B D        Orangutan  cccgccc-------tgccttagc--------cctgccacgtgtgc----c
B D           Gibbon  cccgccc-------tgccttagc--------cctgccatgtgtgc----c
B D           Rhesus  cccgccc-------tgccttagt--------cctgctacgtgtgc----c
B D           Baboon  cccgccc-------tgccttagt--------cctgccacgtgtgc----c
B D         Marmoset  cccgccc-------tgcctcagc--------actgccacgtgtgc----c
B D  Squirrel monkey  cccaccc-------tgcgtcagc--------gctgccacgtgtgc----c
B D          Tarsier  cccgccc-------tgcctcagt--------c---ccctgggtgc----c
B D      Mouse lemur  ccagccc-------agccgca------------cgccccctgtgccaagc
B D         Bushbaby  caagccc-------agccatg------------ccctccatgtac----c
B D              Pig  ttcccca-------aagcacattgc-atcaggcttc--------------
B D          Dolphin  ttcacca-------gcacacatttc-atcaggcttc--------------
B D              Cow  cctgcct-------gccc----------cttgctcc--------------
B D              Cat  tccacca-------gtacacacttc-tgcagccctccatgtg--------
B D              Dog  tctacca-------gcatacatttc-atcagccctccttgtg--------
B D            Panda  tccacca-------gcacacatttc-atcagcccccaacatg--------
B D            Horse  tccacca-------acaaacatttc-gtcagccttccatgtg--------
B D         Microbat  tccacca-------acacacatttc-atcagcccatcgtgtg--------
B D          Megabat  tacaccg-------acacacatttc-atcagccctcaatgtg--------
B D         Elephant  ttcatga-------acacactgtcc-ctcagccccacctatggga----a
B D          Manatee  tttgtca-------acacgcattct-gtctgtcccgcctgtgtga----a
B D        Armadillo  ccccccatacagccacactcgttccgctaaacccctcctgtggcg----c
B D         Squirrel  ==================================================
B D       Guinea pig  ==================================================
B D     Nile tilapia  ==================================================
B D             Fugu  ==================================================
B D     Atlantic cod  ==================================================
B D           Medaka  ==================================================
B D             Pika  ==================================================
B D            Sheep  ==================================================
B D       Budgerigar  ==================================================
B D      Zebra finch  ==================================================
B D           Lizard  ==================================================
B D   Painted turtle  ==================================================
B D          Chicken  ==================================================
B D           Turkey  ==================================================
B D            Shrew  ==================================================
B D       Rock hyrax  ==================================================
B D           Tenrec  ==================================================
B D           Alpaca  ==================================================
B D          Wallaby  ==================================================
B D       Coelacanth  ==================================================
B D    X. tropicalis  ==================================================
B D         Platypus  ==================================================
B D  Tasmanian devil  ==================================================
B D          Opossum  ==================================================

Inserts between block 10 and 11 in window
B D             Rat 6bp
B D    Kangaroo rat 6bp
B D          Rabbit 8bp
B D           Human 15bp
B D           Chimp 15bp
B D         Gorilla 15bp
B D       Orangutan 15bp
B D          Gibbon 15bp
B D          Rhesus 15bp
B D          Baboon 15bp
B D        Marmoset 15bp
B D Squirrel monkey 15bp
B D         Tarsier 16bp
B D     Mouse lemur 16bp
B D        Bushbaby 16bp
B D             Pig 27bp
B D         Dolphin 28bp
B D             Cow 1123bp
B D             Cat 20bp
B D             Dog 22bp
B D           Panda 22bp
B D           Horse 23bp
B D        Microbat 21bp
B D         Megabat 22bp

Alignment block 11 of 516 in window, 115930463 - 115930496, 34 bps 
B D            Mouse  --------caa---------------acaagacac---------------------------ct---gca
B D              Rat  --------caa---------------gcaggacac---------------------------ct---gca
B D     Kangaroo rat  --------cag---------------ggagg-------------------------------ct---gca
B D   Naked mole-rat  --------caaccc-----------tgtgagaccctaag----------------------gct---gct
B D           Rabbit  --------cagtcct-------ccatgctcagccccaca-----------------------ct---gcc
B D            Human  --------caacaccacccaggccaggtagggggctggagc------------ccaggtgggct---gca
B D            Chimp  --------caacaccacccaggccaggcagggggctggagc------------ccaggtgggct---gca
B D          Gorilla  --------caacaccacccaggccaggcagggggctggagc------------ccaggtgggct---gca
B D        Orangutan  --------caacacctcccaggccaggcagggggctggagc------------ccaggtgggct---gca
B D           Gibbon  --------caacaacacccaggccaggcaggggactggagc------------ccaggtgggct---gca
B D           Rhesus  --------caacaccacccaggccaggcagggggctggagc------------ccaggtgggct---aca
B D           Baboon  --------caacaccacccaggccaggcagggggctggagc------------ccaagtgggct---aca
B D         Marmoset  --------caacactgcccaggccaggcagggggctagagc------------ccaggtgggct---gca
B D  Squirrel monkey  --------cagcactgcccaggcgaggcagagggctggcgc------------ccaggtgggct---gta
B D          Tarsier  --------caacactgcccaagacaggcagaggcccgaagc------------ccaggtgggct---aga
B D      Mouse lemur  --------cggcacca-ccgcgacaggcag-ggcctgcggc------------cag--cgggct---gga
B D         Bushbaby  --------tgacaccacccacatcaggcag-ggcctggagc------------aaagctgggct---aga
B D              Pig  -----------------------cag-caggggtttggatc-----------cccaggtg----------
B D          Dolphin  -----------------------cct-caggggtctggagc-----------cccaggtgg---gctgga
B D              Cat  -----------------------caggcagggctctggact-----------ctcaggcaggct---gaa
B D              Dog  -----------------------cag---------------------------cca---gggct---gga
B D            Panda  -----------------------caggtgggg-tctggagc-----------cccaggcgggct---gga
B D            Horse  -----------------------cgg--aggggtctggtcc------------ccaggtgcgct---gga
B D         Microbat  -----------------------caggcaggggtctggagc-----------cccaggtgggct---gga
B D          Megabat  -----------------------gaagcaggggtctagaaa-----------cctaggtgggct---gga
B D         Elephant  aagcc-ttagacacca-----acagggctggaacatgggagttatcatgattcccaggtgggct---g--
B D          Manatee  aagcc-ttagacacca-----acagggctggaacgtgggaggtgtcttgagccccaggtgggct---g--
B D        Armadillo  gcgctggcagacaccacct-cgcctggctgggggaag-----ccccctgaggcctgggtgggct---g--
B D              Cow  ======================================================================
B D         Squirrel  ======================================================================
B D       Guinea pig  ======================================================================
B D     Nile tilapia  ======================================================================
B D             Fugu  ======================================================================
B D     Atlantic cod  ======================================================================
B D           Medaka  ======================================================================
B D             Pika  ======================================================================
B D            Sheep  ======================================================================
B D       Budgerigar  ======================================================================
B D      Zebra finch  ======================================================================
B D           Lizard  ======================================================================
B D   Painted turtle  ======================================================================
B D          Chicken  ======================================================================
B D           Turkey  ======================================================================
B D            Shrew  ======================================================================
B D       Rock hyrax  ======================================================================
B D           Tenrec  ======================================================================
B D           Alpaca  ======================================================================
B D          Wallaby  ======================================================================
B D       Coelacanth  ======================================================================
B D    X. tropicalis  ======================================================================
B D         Platypus  ======================================================================
B D  Tasmanian devil  ======================================================================
B D          Opossum  ======================================================================

               Mouse  tggaaggaaggggg-ttg
                 Rat  tggaatg----ggg-ttg
        Kangaroo rat  ggaaagc--ggggc-aga
      Naked mole-rat  aggaagggtaaggg-ctg
              Rabbit  tgggaggggcaggt-gca
               Human  gggaagg----ggg-ca-
               Chimp  gggaagg----ggg-ca-
             Gorilla  gggaagg----ggg-ca-
           Orangutan  -ggaagg----ggg-cg-
              Gibbon  gggaagg----ggg-ca-
              Rhesus  gggaagg----ggg-ca-
              Baboon  gggaagg----gga-ca-
            Marmoset  gggaagg----ggg-ca-
     Squirrel monkey  gggaagg----ggc-ca-
             Tarsier  gggaagg----gga-ca-
         Mouse lemur  gggaa-------gg-cg-
            Bushbaby  gggaaag----ggg-ca-
                 Pig  ------------------
             Dolphin  gggaagg----ggg-ca-
                 Cat  gggaggg----ggaggg-
                 Dog  gggaagg----ggt----
               Panda  gcgaagg----ggt--a-
               Horse  gggaagg----gaggca-
            Microbat  gggaagg----gaggca-
             Megabat  gggaagg----ggggca-
            Elephant  ------------------
             Manatee  ------------------
           Armadillo  ------------------
                 Cow  ==================
            Squirrel  ==================
          Guinea pig  ==================
        Nile tilapia  ==================
                Fugu  ==================
        Atlantic cod  ==================
              Medaka  ==================
                Pika  ==================
               Sheep  ==================
          Budgerigar  ==================
         Zebra finch  ==================
              Lizard  ==================
      Painted turtle  ==================
             Chicken  ==================
              Turkey  ==================
               Shrew  ==================
          Rock hyrax  ==================
              Tenrec  ==================
              Alpaca  ==================
             Wallaby  ==================
          Coelacanth  ==================
       X. tropicalis  ==================
            Platypus  ==================
     Tasmanian devil  ==================
             Opossum  ==================

Inserts between block 11 and 12 in window
B D  Naked mole-rat 795bp
B D          Rabbit 18bp
B D        Elephant 14bp
B D         Manatee 14bp
B D       Armadillo 13bp

Alignment block 12 of 516 in window, 115930497 - 115930542, 46 bps 
B D            Mouse  ctt-ttcta-agcaaac--atc-taggaatcccgggtgcag-tgtgagg--aga
B D              Rat  cct-ttcta-a----ac--atc-taggaatcccaggcacag-tgtggag--aga
B D     Kangaroo rat  cag-gtctg-agcagacagatc-tagaaatcccatgt---g-ggaagag--aga
B D           Rabbit  ctt-ttctg-agcagacagatg-taagaactcaat------------ag--aga
B D            Human  ctc-ttctg-agcagacagatc-tgggaatcctgg-----g-tgggaag--aga
B D            Chimp  ctc-ttctg-agcagacagatc-tgggaatcctgg-----g-tgggaag--aga
B D          Gorilla  ctc-ttctg-agcagacagatc-tgggaatcctgg-----g-tgggaag--aga
B D        Orangutan  ctc-ttct----------gatc-tgggaatcctag-----g-tgggaag--aga
B D           Gibbon  ctc-ttctg-agcagacagatc-tgggaatcctgg-----g-tgggaag--aga
B D           Rhesus  ctc-ttctg-agcagacagatc-tgggaatcctgg-----g-tgg---g--aga
B D           Baboon  ctc-ttctg-agcagacagatc-tgggaatcctgg-----g-tgg---g--aga
B D         Marmoset  ccc-ttctg-aacagacagatc-taggaatcctgg-----g-tga---------
B D  Squirrel monkey  ccc-ttctg-aacagacagatc-tgggaatcctgg-----g-tgggaag--aga
B D          Tarsier  ctc-ttctg-agtagacacacc-taggaatcgcca-----g-tggggag--aga
B D      Mouse lemur  ctc-ttctg-agcagacagacc-tggga---tcag-----a-tgagaag--aga
B D         Bushbaby  gtt-ttctg-agcagacacacc-tgggaatcccag-----t-tgagaag--aga
B D              Pig  --------------ggctgg-----------------------ggaaag--aga
B D          Dolphin  cat-ttcta-agcagacaggtg-taggaaacccag-----g-tgggaag--aga
B D              Cat  ctt-ttctg-aagaaacaggtc-tgggggtgtcag-----g-ggggaag--aga
B D              Dog  ------ctg-agtgaacaggtc-tgggaatctca------g-tgggaag--aga
B D            Panda  ctt-tcctg-agtgaacaggtc-tgggaatcccag-----g-cgggaag--agg
B D            Horse  tct-ttctgaagcagatagacc-caggaatctcag-----g-ggaagag--aga
B D         Microbat  cttgttttt-agcagacaggtc-taggaagcccag-----g-taggaagggaga
B D          Megabat  ttt-ttctg-agcagacag----------ccccag-----g-ttggaagaaaga
B D         Elephant  ctt-ttctg-agcagacatgatccaggaaccccag-----attgggaag--aaa
B D          Manatee  ctt-ttctg-agcagatcgagtccacgaatcccag-----ggtaggaag--aga
B D        Armadillo  ccg-tgctg-agcagatggagg-gaggcatcccag-----gcagggaag--aga
B D              Cow  ======================================================
B D         Squirrel  ======================================================
B D       Guinea pig  ======================================================
B D   Naked mole-rat  ======================================================
B D     Nile tilapia  ======================================================
B D             Fugu  ======================================================
B D     Atlantic cod  ======================================================
B D           Medaka  ======================================================
B D             Pika  ======================================================
B D            Sheep  ======================================================
B D       Budgerigar  ======================================================
B D      Zebra finch  ======================================================
B D           Lizard  ======================================================
B D   Painted turtle  ======================================================
B D          Chicken  ======================================================
B D           Turkey  ======================================================
B D            Shrew  ======================================================
B D       Rock hyrax  ======================================================
B D           Tenrec  ======================================================
B D           Alpaca  ======================================================
B D          Wallaby  ======================================================
B D       Coelacanth  ======================================================
B D    X. tropicalis  ======================================================
B D         Platypus  ======================================================
B D  Tasmanian devil  ======================================================
B D          Opossum  ======================================================

Inserts between block 12 and 13 in window
B D           Human 2bp
B D           Chimp 2bp
B D         Gorilla 2bp
B D       Orangutan 2bp
B D          Gibbon 2bp
B D          Rhesus 2bp
B D          Baboon 2bp
B D Squirrel monkey 2bp
B D         Tarsier 536bp
B D     Mouse lemur 2bp
B D        Bushbaby 2bp
B D        Elephant 2bp
B D         Manatee 2bp
B D       Armadillo 2bp

Alignment block 13 of 516 in window, 115930543 - 115930554, 12 bps 
B D            Mouse  ct-aggcgaggga
B D              Rat  cttaagcaaggga
B D     Kangaroo rat  ct--ggacacaga
B D           Rabbit  ct-gggtgagaga
B D            Human  c---agtgagaga
B D            Chimp  ct-gggtgagaga
B D          Gorilla  ct-gggtgagaga
B D        Orangutan  ct-gggtgagaga
B D           Gibbon  ct-gggt----ga
B D           Rhesus  ct-gggtatgaca
B D           Baboon  ct-gggtatgaca
B D         Marmoset  ---------gaga
B D  Squirrel monkey  cc-gggt--gaga
B D      Mouse lemur  ct-gggcgagaga
B D         Bushbaby  ct-gggtgagaga
B D              Pig  aa-gggcaggaga
B D          Dolphin  aactagcatgagg
B D              Cat  ct-gcactgaaga
B D              Dog  ct-acacacagga
B D            Panda  ct-gcacgaa--a
B D            Horse  ct-gggtgagaga
B D         Microbat  ct-gggtgtcagc
B D          Megabat  ct-gggtaacaga
B D         Elephant  ct-agacgagaga
B D          Manatee  ct-agacaagaaa
B D        Armadillo  cg-ag-cgagag-
B D              Cow  =============
B D         Squirrel  =============
B D       Guinea pig  =============
B D   Naked mole-rat  =============
B D     Nile tilapia  =============
B D             Fugu  =============
B D     Atlantic cod  =============
B D           Medaka  =============
B D             Pika  =============
B D          Tarsier  =============
B D            Sheep  =============
B D       Budgerigar  =============
B D      Zebra finch  =============
B D           Lizard  =============
B D   Painted turtle  =============
B D          Chicken  =============
B D           Turkey  =============
B D            Shrew  =============
B D       Rock hyrax  =============
B D           Tenrec  =============
B D           Alpaca  =============
B D          Wallaby  =============
B D       Coelacanth  =============
B D    X. tropicalis  =============
B D         Platypus  =============
B D  Tasmanian devil  =============
B D          Opossum  =============

Inserts between block 13 and 14 in window
B D         Manatee 1711bp

Alignment block 14 of 516 in window, 115930555 - 115930566, 12 bps 
B D            Mouse  g-------------tacttta-----aggg
B D              Rat  g-------------tgcta-a-----agag
B D     Kangaroo rat  g-------------ggctt-a-----agag
B D           Rabbit  g-------------agaga-a-----gggg
B D            Human  g-------------agatt-a-----aggg
B D            Chimp  g-------------agatt-a-----aggg
B D          Gorilla  g-------------agatt-a-----aggg
B D        Orangutan  g-------------agatt-a-----aggg
B D           Gibbon  g-------------agatt-a-----aggg
B D           Rhesus  g-------------agatt-a-----aggg
B D           Baboon  g-------------agatt-a-----aggg
B D         Marmoset  g-------------agatt-a-----aggg
B D  Squirrel monkey  g-------------agatt-a-----aaga
B D      Mouse lemur  gcttggggacccgcgtcct-ggggacaggg
B D         Bushbaby  g-------------agctt-agggacaggg
B D              Pig  g-------------ggc-t-g-----aggg
B D          Dolphin  g-------------aactt-a-----agtg
B D              Cat  g-------------agtat-a-----aggg
B D              Dog  g-------------agtac-t-----aggg
B D            Panda  g-------------agtgc-t-----aggg
B D            Horse  g-------------agctt-a-----aggg
B D         Microbat  a-------------agctc-a-----aggg
B D          Megabat  g-------------agctt-a-----aggg
B D         Elephant  a-------------agtgt-a-----aggg
B D        Armadillo  ---------------gctt-c-----aggg
B D              Cow  ==============================
B D         Squirrel  ==============================
B D          Manatee  ==============================
B D       Guinea pig  ==============================
B D   Naked mole-rat  ==============================
B D     Nile tilapia  ==============================
B D             Fugu  ==============================
B D     Atlantic cod  ==============================
B D           Medaka  ==============================
B D             Pika  ==============================
B D          Tarsier  ==============================
B D            Sheep  ==============================
B D       Budgerigar  ==============================
B D      Zebra finch  ==============================
B D           Lizard  ==============================
B D   Painted turtle  ==============================
B D          Chicken  ==============================
B D           Turkey  ==============================
B D            Shrew  ==============================
B D       Rock hyrax  ==============================
B D           Tenrec  ==============================
B D           Alpaca  ==============================
B D          Wallaby  ==============================
B D       Coelacanth  ==============================
B D    X. tropicalis  ==============================
B D         Platypus  ==============================
B D  Tasmanian devil  ==============================
B D          Opossum  ==============================

Inserts between block 14 and 15 in window
B D        Elephant 1896bp
B D       Armadillo 1bp

Alignment block 15 of 516 in window, 115930567 - 115930595, 29 bps 
B D            Mouse  cctca-aggctc------------------------------------------------agagaggaat
B D              Rat  cctca-aggctc------------------------------------------------agagaggaat
B D     Kangaroo rat  ccc---aatctc------------------------------------------------agagacaggg
B D           Rabbit  gggaagtatctc------------------------------------------------agagacaggg
B D            Human  ata---tttccc----------------------------------------------------------
B D            Chimp  ata---tttccc----------------------------------------------------------
B D          Gorilla  ata---tttcct----------------------------------------------------------
B D        Orangutan  ata---tttccc----------------------------------------------------------
B D           Gibbon  ata---tttccctggcatcagggctctgcactctcaggggtccttcctcctggat---------------
B D           Rhesus  atg---tttccc----------------------------------------------------------
B D           Baboon  atg---tttccc----------------------------------------------------------
B D         Marmoset  aca---ctttcctggcctcagggctctgcactcgcaggggtccctctgcccggat---------------
B D  Squirrel monkey  aca---ctctcccggcctcagggctctgcactcgcagggggccctctgcccggac---------------
B D      Mouse lemur  aca---g-tgct-------------------------------------------ggc------------
B D         Bushbaby  atg---gttgct-------------------------------------------ggc------------
B D              Pig  gtg---cgtctc------------------------------------------------agagactggg
B D          Dolphin  atgga-agtctt------------------------------------------------gaagactggt
B D              Cat  ctgga-agtctc------------------------------------------------agagatgggg
B D              Dog  atgga-agtctc------------------------------------------------agaaacaggg
B D            Panda  aagga-agactt------------------------------------------------ggagacaggg
B D            Horse  ataga-agtctt------------------------------------------------gtggacaggg
B D         Microbat  ataga-agtctc------------------------------------------------agagacaggg
B D          Megabat  atgga-agtctt------------------------------------------------ggagacaggg
B D        Armadillo  ---------------------------------------------------aggtggtcgagagataggg
B D              Cow  ======================================================================
B D         Squirrel  ======================================================================
B D          Manatee  ======================================================================
B D         Elephant  ======================================================================
B D       Guinea pig  ======================================================================
B D   Naked mole-rat  ======================================================================
B D     Nile tilapia  ======================================================================
B D             Fugu  ======================================================================
B D     Atlantic cod  ======================================================================
B D           Medaka  ======================================================================
B D             Pika  ======================================================================
B D          Tarsier  ======================================================================
B D            Sheep  ======================================================================
B D       Budgerigar  ======================================================================
B D      Zebra finch  ======================================================================
B D           Lizard  ======================================================================
B D   Painted turtle  ======================================================================
B D          Chicken  ======================================================================
B D           Turkey  ======================================================================
B D            Shrew  ======================================================================
B D       Rock hyrax  ======================================================================
B D           Tenrec  ======================================================================
B D           Alpaca  ======================================================================
B D          Wallaby  ======================================================================
B D       Coelacanth  ======================================================================
B D    X. tropicalis  ======================================================================
B D         Platypus  ======================================================================
B D  Tasmanian devil  ======================================================================
B D          Opossum  ======================================================================

               Mouse  ac--ttc---ttc-
                 Rat  ac--ttc-------
        Kangaroo rat  ac--tcc---tg--
              Rabbit  acagtcc-------
               Human  --------------
               Chimp  --------------
             Gorilla  --------------
           Orangutan  --------------
              Gibbon  --------------
              Rhesus  --------------
              Baboon  --------------
            Marmoset  --------------
     Squirrel monkey  --------------
         Mouse lemur  --------------
            Bushbaby  --------------
                 Pig  atgcctc-------
             Dolphin  acacttc-------
                 Cat  acacttc-------
                 Dog  acacttcccc----
               Panda  acacttcccc----
               Horse  acacttc-------
            Microbat  acacttc-------
             Megabat  atacttc-------
           Armadillo  accccta------c
                 Cow  ==============
            Squirrel  ==============
             Manatee  ==============
            Elephant  ==============
          Guinea pig  ==============
      Naked mole-rat  ==============
        Nile tilapia  ==============
                Fugu  ==============
        Atlantic cod  ==============
              Medaka  ==============
                Pika  ==============
             Tarsier  ==============
               Sheep  ==============
          Budgerigar  ==============
         Zebra finch  ==============
              Lizard  ==============
      Painted turtle  ==============
             Chicken  ==============
              Turkey  ==============
               Shrew  ==============
          Rock hyrax  ==============
              Tenrec  ==============
              Alpaca  ==============
             Wallaby  ==============
          Coelacanth  ==============
       X. tropicalis  ==============
            Platypus  ==============
     Tasmanian devil  ==============
             Opossum  ==============

Inserts between block 15 and 16 in window
B D          Gibbon 650bp
B D          Rhesus 2bp
B D          Baboon 2bp
B D     Mouse lemur 14bp
B D        Bushbaby 14bp
B D           Panda 954bp

Alignment block 16 of 516 in window, 115930596 - 115930612, 17 bps 
B D            Mouse  cctggttagcctcgtgc
B D              Rat  cctggtcagcctgg-gc
B D     Kangaroo rat  tctggccagtgtct---
B D           Rabbit  cccactgaccttctgcc
B D              Pig  cctgctcgcattgtatt
B D          Dolphin  cctggccggcctgtatt
B D              Cat  cctggccgactccttcc
B D              Dog  ----accggctccttct
B D            Horse  cctggccagccttgaat
B D         Microbat  -cctgctggccttgaat
B D          Megabat  -cctgctgaccttggat
B D        Armadillo  cccggcagcctgctgc-
B D              Cow  =================
B D         Bushbaby  =================
B D         Squirrel  =================
B D            Panda  =================
B D  Squirrel monkey  -----------------
B D          Gorilla  -----------------
B D            Chimp  -----------------
B D            Human  -----------------
B D          Manatee  =================
B D         Elephant  =================
B D       Guinea pig  =================
B D   Naked mole-rat  =================
B D         Marmoset  -----------------
B D           Rhesus  =================
B D           Gibbon  =================
B D        Orangutan  -----------------
B D     Nile tilapia  =================
B D             Fugu  =================
B D     Atlantic cod  =================
B D           Medaka  =================
B D             Pika  =================
B D          Tarsier  =================
B D            Sheep  =================
B D       Budgerigar  =================
B D      Zebra finch  =================
B D           Lizard  =================
B D   Painted turtle  =================
B D          Chicken  =================
B D           Turkey  =================
B D      Mouse lemur  =================
B D            Shrew  =================
B D       Rock hyrax  =================
B D           Tenrec  =================
B D           Alpaca  =================
B D          Wallaby  =================
B D           Baboon  =================
B D       Coelacanth  =================
B D    X. tropicalis  =================
B D         Platypus  =================
B D  Tasmanian devil  =================
B D          Opossum  =================

Inserts between block 16 and 17 in window
B D             Pig 1bp
B D         Dolphin 1bp
B D             Cat 308bp
B D             Dog 4bp
B D           Horse 1bp
B D        Microbat 1bp
B D         Megabat 1bp

Alignment block 17 of 516 in window, 115930613 - 115930683, 71 bps 
B D            Mouse  ctaggctccagggtctttgtc---------------ctgcctggatacctatgt----------------
B D              Rat  ccaggctcccaggtctttgta---------------ctgcctgaatgcccatgt----------------
B D     Kangaroo rat  cccaacctcagggcctttgcacttgct---gtccctctgcctagacacctttgc----------------
B D           Rabbit  ccttgcctcagggcctgtgcacgtgct---gttcctctgc-----tatctgcct----------------
B D            Human  --aggcatca-gggctttgcactctcaggggtccttccgcctggatgtccttcc----------------
B D            Chimp  --aggcatca-gggctttgcactctcaggggtccttccgcctggatgtccttcc----------------
B D          Gorilla  --aggcatca-gggctttgcactttcaggggtccttccgcctggatgtccttcc----------------
B D        Orangutan  --tggcctca-gggctctgcactctcaggggtccttccgcctggatgtccttcc----------------
B D           Rhesus  ----gcctca-gggctctgcacttgccggggtccttctgcctggatgtccttcc----------------
B D           Baboon  ----gcctca-gggctctgcgctcgccggggtccttctgcctggatgtccttcc----------------
B D         Marmoset  ----------------------------------------------gaccttcc----------------
B D  Squirrel monkey  ----------------------------------------------gaccttcc----------------
B D      Mouse lemur  --tagcctca-ggcctcggca-ctgca--gttccctccgcctggacgcctt--c----------------
B D         Bushbaby  --tgggctcagggcgtctgtgtttgca--gtaccctctgtctgagcacctttcc----------------
B D              Pig  -ccagcctcagggcctttgcacttgct--gctccctctccctggacatctccac----------------
B D          Dolphin  -ccagactcaggacctttgcacgtgct--gttctctctcgctgagcgtctctac----------------
B D              Dog  -------------------------cc--aaattcccagttcaaacctccacct----------------
B D            Horse  cccagcttcagggcctttgcacttgct--gttttctctgcctggacatctccac----------------
B D         Microbat  tccagccacagggcctttgcacttgct--gtttcctctgcctaaacaacccagc----------------
B D          Megabat  cccggcctcagggtctttgcacttgct--gttccctctgcctggatatctcctccgccgccaccaccatc
B D        Armadillo  --ctgccccagggcctttgcactcgct--------------------cccctct----------------
B D              Cow  ======================================================================
B D         Squirrel  ======================================================================
B D            Panda  ======================================================================
B D          Manatee  ======================================================================
B D         Elephant  ======================================================================
B D       Guinea pig  ======================================================================
B D   Naked mole-rat  ======================================================================
B D           Gibbon  ======================================================================
B D     Nile tilapia  ======================================================================
B D             Fugu  ======================================================================
B D     Atlantic cod  ======================================================================
B D           Medaka  ======================================================================
B D             Pika  ======================================================================
B D          Tarsier  ======================================================================
B D            Sheep  ======================================================================
B D       Budgerigar  ======================================================================
B D      Zebra finch  ======================================================================
B D           Lizard  ======================================================================
B D   Painted turtle  ======================================================================
B D          Chicken  ======================================================================
B D           Turkey  ======================================================================
B D              Cat  ======================================================================
B D            Shrew  ======================================================================
B D       Rock hyrax  ======================================================================
B D           Tenrec  ======================================================================
B D           Alpaca  ======================================================================
B D          Wallaby  ======================================================================
B D       Coelacanth  ======================================================================
B D    X. tropicalis  ======================================================================
B D         Platypus  ======================================================================
B D  Tasmanian devil  ======================================================================
B D          Opossum  ======================================================================

               Mouse  ------------ggcaag----gggcatagc--atttcc-cccaccat-ca-g
                 Rat  ------------ggcaag----gggcaaggc--attttctcccactat-ca-g
        Kangaroo rat  ------------cccaag----g------------ctcctcccatcacgca-g
              Rabbit  ------------gccgat----tggcatagct-ggttcttcccgccat-tc-a
               Human  ------------cctgaa---------------gcttcctcctgttgttcc-g
               Chimp  ------------cctaaa---------------gcttcctcctgttgttcc-g
             Gorilla  ------------cctgaa---------------gcttcctcctgttgttcc-g
           Orangutan  ------------cctgaa---------------gcttcctcctgttgttcc-g
              Rhesus  ------------cctgaa---------------gcttcctcctgttgttcc-a
              Baboon  ------------cctgaa---------------gcttcctcctgttgttcc-a
            Marmoset  ------------cctgaa---------------gcttccgcctgttgttccgg
     Squirrel monkey  ------------cctgaa---------------gcttcctcctgttgctctgg
         Mouse lemur  ------------cccaca---------------gcctcctccc-cccgccg-g
            Bushbaby  ------------cccaca---------------gctcctgcca-tcattct-g
                 Pig  ------------ccctag-----------------------------------
             Dolphin  ------------ccccac-----------------------------------
                 Dog  -----------tcccaggctgctcca--aatg-acagtgtgttgggagtgg--
               Horse  -----------tccctagatcctcca-gggct-gccctcttccatcactga--
            Microbat  ------------ccccagatcttggcagggct-ggctccttccatcattga--
             Megabat  actaccacccctccccagatcttggagggtct-gg-tgcttccatcactga--
           Armadillo  ------------cccatc---ttggcgtggctggtttcttcccatcatttg-g
                 Cow  =====================================================
            Squirrel  =====================================================
               Panda  =====================================================
             Manatee  =====================================================
            Elephant  =====================================================
          Guinea pig  =====================================================
      Naked mole-rat  =====================================================
              Gibbon  =====================================================
        Nile tilapia  =====================================================
                Fugu  =====================================================
        Atlantic cod  =====================================================
              Medaka  =====================================================
                Pika  =====================================================
             Tarsier  =====================================================
               Sheep  =====================================================
          Budgerigar  =====================================================
         Zebra finch  =====================================================
              Lizard  =====================================================
      Painted turtle  =====================================================
             Chicken  =====================================================
              Turkey  =====================================================
                 Cat  =====================================================
               Shrew  =====================================================
          Rock hyrax  =====================================================
              Tenrec  =====================================================
              Alpaca  =====================================================
             Wallaby  =====================================================
          Coelacanth  =====================================================
       X. tropicalis  =====================================================
            Platypus  =====================================================
     Tasmanian devil  =====================================================
             Opossum  =====================================================

Inserts between block 17 and 18 in window
B D             Pig 90bp
B D         Dolphin 2bp
B D             Dog 1bp
B D           Horse 1bp
B D        Microbat 1bp
B D         Megabat 1bp

Alignment block 18 of 516 in window, 115930684 - 115930709, 26 bps 
B D            Mouse  ctcttagctcaa-ccttatc------ttctcg-------------------------g-
B D              Rat  ttcttagctcaa-ccttacc------ttctta-------------------------g-
B D     Kangaroo rat  ctcccggctcac-attcacc------ctccca-------------------------g-
B D           Rabbit  gtcctagctcg---tttcac------ttctca-------------------------g-
B D            Human  ttctcagctcaagctccagc------ttctca-------------------------g-
B D            Chimp  ttctcggctcaagctccagc------ttctca-------------------------g-
B D          Gorilla  ttctcggctcaagctccagc------ttctca-------------------------g-
B D        Orangutan  ttctcggctcaagctccagc------ttctca-------------------------g-
B D           Rhesus  ttctcggcttaagctccagc------ttctca-------------------------g-
B D           Baboon  ttctcggcttaagctccagc------ttctca-------------------------g-
B D         Marmoset  ctctccactcaagctccagc------ttctca-------------------------g-
B D  Squirrel monkey  ctctccactcatgctccagc------ttctca-------------------------g-
B D      Mouse lemur  ttcccagccc-------------------------------------------------
B D         Bushbaby  ctttcatctcaagcatcacc------tcctgg-------------------------g-
B D          Dolphin  -----aactc--cttccacccttgagttctca-------------------------g-
B D              Dog  tcacaagctgaacttttcct------atctcatttgtttcaatacttgtttatttgta-
B D            Horse  ttcccagttcaaacttcacc------ttctca----------------------gaga-
B D         Microbat  ttctcagctcaaacttcacc-------tctga-------------------------g-
B D          Megabat  ttcgcagctcaaacttcacc------ttctca-------------------------g-
B D        Armadillo  ttctcagctccaacttgccc------tcccca-------------------------gg
B D              Pig  ===========================================================
B D              Cow  ===========================================================
B D         Squirrel  ===========================================================
B D            Panda  ===========================================================
B D          Manatee  ===========================================================
B D         Elephant  ===========================================================
B D       Guinea pig  ===========================================================
B D   Naked mole-rat  ===========================================================
B D           Gibbon  ===========================================================
B D     Nile tilapia  ===========================================================
B D             Fugu  ===========================================================
B D     Atlantic cod  ===========================================================
B D           Medaka  ===========================================================
B D             Pika  ===========================================================
B D          Tarsier  ===========================================================
B D            Sheep  ===========================================================
B D       Budgerigar  ===========================================================
B D      Zebra finch  ===========================================================
B D           Lizard  ===========================================================
B D   Painted turtle  ===========================================================
B D          Chicken  ===========================================================
B D           Turkey  ===========================================================
B D              Cat  ===========================================================
B D            Shrew  ===========================================================
B D       Rock hyrax  ===========================================================
B D           Tenrec  ===========================================================
B D           Alpaca  ===========================================================
B D          Wallaby  ===========================================================
B D       Coelacanth  ===========================================================
B D    X. tropicalis  ===========================================================
B D         Platypus  ===========================================================
B D  Tasmanian devil  ===========================================================
B D          Opossum  ===========================================================

Inserts between block 18 and 19 in window
B D    Kangaroo rat 589bp
B D           Human 1bp
B D           Chimp 1bp
B D         Gorilla 1bp
B D       Orangutan 1bp
B D          Rhesus 1bp
B D          Baboon 1bp
B D        Marmoset 1bp
B D Squirrel monkey 1bp
B D        Bushbaby 1bp
B D         Dolphin 1bp
B D             Dog 8bp
B D           Horse 8bp
B D        Microbat 8bp
B D         Megabat 1bp

Alignment block 19 of 516 in window, 115930710 - 115930715, 6 bps 
B D            Mouse  aaagac
B D              Rat  aaaggc
B D           Rabbit  agaggc
B D            Human  gaagcc
B D            Chimp  gaagcc
B D          Gorilla  gaagcc
B D        Orangutan  gaagcc
B D           Rhesus  gaagcc
B D           Baboon  gaagcc
B D         Marmoset  gaagcc
B D  Squirrel monkey  gaagcc
B D      Mouse lemur  -gggct
B D         Bushbaby  gaggct
B D          Dolphin  gaggc-
B D              Dog  ta----
B D            Horse  caggc-
B D         Microbat  caggc-
B D          Megabat  gaggc-
B D        Armadillo  gaggcc
B D              Pig  ======
B D              Cow  ======
B D         Squirrel  ======
B D            Panda  ======
B D          Manatee  ======
B D         Elephant  ======
B D       Guinea pig  ======
B D   Naked mole-rat  ======
B D           Gibbon  ======
B D     Nile tilapia  ======
B D             Fugu  ======
B D     Atlantic cod  ======
B D           Medaka  ======
B D             Pika  ======
B D          Tarsier  ======
B D            Sheep  ======
B D       Budgerigar  ======
B D      Zebra finch  ======
B D           Lizard  ======
B D   Painted turtle  ======
B D          Chicken  ======
B D           Turkey  ======
B D              Cat  ======
B D            Shrew  ======
B D       Rock hyrax  ======
B D           Tenrec  ======
B D           Alpaca  ======
B D          Wallaby  ======
B D     Kangaroo rat  ======
B D       Coelacanth  ======
B D    X. tropicalis  ======
B D         Platypus  ======
B D  Tasmanian devil  ======
B D          Opossum  ======

Inserts between block 19 and 20 in window
B D         Dolphin 952bp
B D           Horse 1bp
B D        Microbat 1bp
B D         Megabat 1bp

Alignment block 20 of 516 in window, 115930716 - 115930719, 4 bps 
B D            Mouse  -tgc---g
B D              Rat  -tgt---g
B D           Rabbit  -cccatgg
B D            Human  -tcc----
B D            Chimp  -tcc----
B D          Gorilla  -tcc----
B D        Orangutan  -tcc----
B D           Rhesus  -tcc----
B D           Baboon  -tcc----
B D         Marmoset  -tcc----
B D  Squirrel monkey  -tcc----
B D      Mouse lemur  -tcc----
B D         Bushbaby  -tcc----
B D              Dog  -acc----
B D            Horse  -gct----
B D         Microbat  -gct----
B D          Megabat  -gct----
B D        Armadillo  tgcc----
B D              Pig  ========
B D              Cow  ========
B D         Squirrel  ========
B D            Panda  ========
B D          Manatee  ========
B D         Elephant  ========
B D       Guinea pig  ========
B D   Naked mole-rat  ========
B D           Gibbon  ========
B D     Nile tilapia  ========
B D             Fugu  ========
B D     Atlantic cod  ========
B D           Medaka  ========
B D             Pika  ========
B D          Dolphin  ========
B D          Tarsier  ========
B D            Sheep  ========
B D       Budgerigar  ========
B D      Zebra finch  ========
B D           Lizard  ========
B D   Painted turtle  ========
B D          Chicken  ========
B D           Turkey  ========
B D              Cat  ========
B D            Shrew  ========
B D       Rock hyrax  ========
B D           Tenrec  ========
B D           Alpaca  ========
B D          Wallaby  ========
B D     Kangaroo rat  ========
B D       Coelacanth  ========
B D    X. tropicalis  ========
B D         Platypus  ========
B D  Tasmanian devil  ========
B D          Opossum  ========

Inserts between block 20 and 21 in window
B D           Human 8bp
B D           Chimp 8bp
B D         Gorilla 8bp
B D       Orangutan 8bp
B D          Rhesus 8bp
B D          Baboon 8bp
B D        Marmoset 56bp
B D Squirrel monkey 87bp
B D     Mouse lemur 15bp
B D        Bushbaby 32bp
B D             Dog 3bp
B D           Horse 3bp
B D        Microbat 3bp
B D         Megabat 3bp

Alignment block 21 of 516 in window, 115930720 - 115930725, 6 bps 
B D            Mouse  --cagtgt--------
B D              Rat  --cagtgt--------
B D           Rabbit  --ctgtgt--------
B D            Human  --gagtg---------
B D            Chimp  --gagtg---------
B D          Gorilla  --gagtg---------
B D        Orangutan  --gagtg---------
B D           Rhesus  --gagtg---------
B D           Baboon  --gagtg---------
B D      Mouse lemur  --gaccg---------
B D         Bushbaby  --gaagg---------
B D              Dog  --cag-----------
B D            Horse  --gat-----------
B D         Microbat  --gat-----------
B D          Megabat  --gag-----------
B D        Armadillo  ctggttg-ctctctat
B D              Pig  ================
B D              Cow  ================
B D         Squirrel  ================
B D            Panda  ================
B D  Squirrel monkey  ================
B D          Manatee  ================
B D         Elephant  ================
B D       Guinea pig  ================
B D   Naked mole-rat  ================
B D         Marmoset  ================
B D           Gibbon  ================
B D     Nile tilapia  ================
B D             Fugu  ================
B D     Atlantic cod  ================
B D           Medaka  ================
B D             Pika  ================
B D          Dolphin  ================
B D          Tarsier  ================
B D            Sheep  ================
B D       Budgerigar  ================
B D      Zebra finch  ================
B D           Lizard  ================
B D   Painted turtle  ================
B D          Chicken  ================
B D           Turkey  ================
B D              Cat  ================
B D            Shrew  ================
B D       Rock hyrax  ================
B D           Tenrec  ================
B D           Alpaca  ================
B D          Wallaby  ================
B D     Kangaroo rat  ================
B D       Coelacanth  ================
B D    X. tropicalis  ================
B D         Platypus  ================
B D  Tasmanian devil  ================
B D          Opossum  ================

Inserts between block 21 and 22 in window
B D          Rabbit 311bp

Alignment block 22 of 516 in window, 115930726 - 115930730, 5 bps 
B D            Mouse  aacaa
B D              Rat  aacta
B D              Dog  ---aa
B D            Horse  ---aa
B D         Microbat  ---aa
B D          Megabat  ---aa
B D        Armadillo  -aaaa
B D              Pig  =====
B D              Cow  =====
B D           Rabbit  =====
B D         Bushbaby  -----
B D         Squirrel  =====
B D            Panda  =====
B D  Squirrel monkey  =====
B D          Gorilla  -----
B D            Chimp  -----
B D            Human  -----
B D          Manatee  =====
B D         Elephant  =====
B D       Guinea pig  =====
B D   Naked mole-rat  =====
B D         Marmoset  =====
B D           Rhesus  -----
B D           Gibbon  =====
B D        Orangutan  -----
B D     Nile tilapia  =====
B D             Fugu  =====
B D     Atlantic cod  =====
B D           Medaka  =====
B D             Pika  =====
B D          Dolphin  =====
B D          Tarsier  =====
B D            Sheep  =====
B D       Budgerigar  =====
B D      Zebra finch  =====
B D           Lizard  =====
B D   Painted turtle  =====
B D          Chicken  =====
B D           Turkey  =====
B D      Mouse lemur  -----
B D              Cat  =====
B D            Shrew  =====
B D       Rock hyrax  =====
B D           Tenrec  =====
B D           Alpaca  =====
B D          Wallaby  =====
B D           Baboon  -----
B D     Kangaroo rat  =====
B D       Coelacanth  =====
B D    X. tropicalis  =====
B D         Platypus  =====
B D  Tasmanian devil  =====
B D          Opossum  =====

Inserts between block 22 and 23 in window
B D             Dog 7bp
B D           Horse 9bp
B D        Microbat 75bp
B D         Megabat 7bp

Alignment block 23 of 516 in window, 115930731 - 115930741, 11 bps 
B D            Mouse  cacagcagaga
B D              Rat  cacagtgggaa
B D            Human  ----gctgcga
B D            Chimp  ----gctgcga
B D          Gorilla  ----gctgcga
B D        Orangutan  ----gctgcga
B D           Rhesus  ----gctgcga
B D           Baboon  ----gctgcga
B D      Mouse lemur  ----gccacca
B D         Bushbaby  ----gtcacca
B D              Dog  ---tcctgcag
B D            Horse  ---gggagcag
B D          Megabat  ---gggagtgg
B D        Armadillo  cacagcatgga
B D              Pig  ===========
B D              Cow  ===========
B D           Rabbit  ===========
B D         Squirrel  ===========
B D            Panda  ===========
B D  Squirrel monkey  ===========
B D          Manatee  ===========
B D         Elephant  ===========
B D       Guinea pig  ===========
B D   Naked mole-rat  ===========
B D         Marmoset  ===========
B D           Gibbon  ===========
B D     Nile tilapia  ===========
B D         Microbat  ===========
B D             Fugu  ===========
B D     Atlantic cod  ===========
B D           Medaka  ===========
B D             Pika  ===========
B D          Dolphin  ===========
B D          Tarsier  ===========
B D            Sheep  ===========
B D       Budgerigar  ===========
B D      Zebra finch  ===========
B D           Lizard  ===========
B D   Painted turtle  ===========
B D          Chicken  ===========
B D           Turkey  ===========
B D              Cat  ===========
B D            Shrew  ===========
B D       Rock hyrax  ===========
B D           Tenrec  ===========
B D           Alpaca  ===========
B D          Wallaby  ===========
B D     Kangaroo rat  ===========
B D       Coelacanth  ===========
B D    X. tropicalis  ===========
B D         Platypus  ===========
B D  Tasmanian devil  ===========
B D          Opossum  ===========

Inserts between block 23 and 24 in window
B D       Armadillo 527bp

Alignment block 24 of 516 in window, 115930742 - 115930742, 1 bps 
B D            Mouse  c-------------
B D              Rat  c-------------
B D            Human  c-------------
B D            Chimp  c-------------
B D          Gorilla  c-------------
B D        Orangutan  c-------------
B D           Rhesus  a-------------
B D           Baboon  a-------------
B D      Mouse lemur  c-------------
B D         Bushbaby  c-------------
B D              Dog  gc----------at
B D            Horse  gtcacgatctgaat
B D          Megabat  gt------ctgaat
B D              Pig  ==============
B D              Cow  ==============
B D           Rabbit  ==============
B D         Squirrel  ==============
B D            Panda  ==============
B D  Squirrel monkey  ==============
B D          Manatee  ==============
B D         Elephant  ==============
B D       Guinea pig  ==============
B D   Naked mole-rat  ==============
B D         Marmoset  ==============
B D           Gibbon  ==============
B D     Nile tilapia  ==============
B D         Microbat  ==============
B D             Fugu  ==============
B D     Atlantic cod  ==============
B D           Medaka  ==============
B D             Pika  ==============
B D          Dolphin  ==============
B D          Tarsier  ==============
B D        Armadillo  ==============
B D            Sheep  ==============
B D       Budgerigar  ==============
B D      Zebra finch  ==============
B D           Lizard  ==============
B D   Painted turtle  ==============
B D          Chicken  ==============
B D           Turkey  ==============
B D              Cat  ==============
B D            Shrew  ==============
B D       Rock hyrax  ==============
B D           Tenrec  ==============
B D           Alpaca  ==============
B D          Wallaby  ==============
B D     Kangaroo rat  ==============
B D       Coelacanth  ==============
B D    X. tropicalis  ==============
B D         Platypus  ==============
B D  Tasmanian devil  ==============
B D          Opossum  ==============

Alignment block 25 of 516 in window, 115930743 - 115930744, 2 bps 
B D            Mouse  -tt
B D              Rat  -tt
B D            Human  -tg
B D            Chimp  -tg
B D          Gorilla  -tg
B D        Orangutan  -tg
B D           Rhesus  -tg
B D           Baboon  -tg
B D      Mouse lemur  -tg
B D         Bushbaby  -tg
B D              Pig  tt-
B D              Dog  cc-
B D            Horse  tt-
B D          Megabat  tt-
B D              Cow  ===
B D           Rabbit  ===
B D         Squirrel  ===
B D            Panda  ===
B D  Squirrel monkey  ===
B D          Manatee  ===
B D         Elephant  ===
B D       Guinea pig  ===
B D   Naked mole-rat  ===
B D         Marmoset  ===
B D           Gibbon  ===
B D     Nile tilapia  ===
B D         Microbat  ===
B D             Fugu  ===
B D     Atlantic cod  ===
B D           Medaka  ===
B D             Pika  ===
B D          Dolphin  ===
B D          Tarsier  ===
B D        Armadillo  ===
B D            Sheep  ===
B D       Budgerigar  ===
B D      Zebra finch  ===
B D           Lizard  ===
B D   Painted turtle  ===
B D          Chicken  ===
B D           Turkey  ===
B D              Cat  ===
B D            Shrew  ===
B D       Rock hyrax  ===
B D           Tenrec  ===
B D           Alpaca  ===
B D          Wallaby  ===
B D     Kangaroo rat  ===
B D       Coelacanth  ===
B D    X. tropicalis  ===
B D         Platypus  ===
B D  Tasmanian devil  ===
B D          Opossum  ===

Inserts between block 25 and 26 in window
B D           Human 14bp
B D           Chimp 14bp
B D         Gorilla 14bp
B D       Orangutan 14bp
B D          Rhesus 14bp
B D          Baboon 14bp
B D     Mouse lemur 13bp
B D        Bushbaby 13bp

Alignment block 26 of 516 in window, 115930745 - 115930759, 15 bps 
B D            Mouse  ttctt-ttgtcccctg
B D              Rat  ttctt-ttgttccctg
B D            Human  ttatt-cgctcttcta
B D            Chimp  ttatt-cgctcttcta
B D          Gorilla  ttatt-cgctcttcta
B D        Orangutan  ttatt-cgctcctcta
B D           Rhesus  ttttt-cgctccacta
B D           Baboon  ttttt-cgctccacta
B D      Mouse lemur  tcatt-tgtttcattt
B D         Bushbaby  ttact-tgtcttattt
B D              Pig  ttatt-tcattacttg
B D              Dog  tcctt-ctgcactgca
B D            Horse  ttcttattgttatttg
B D          Megabat  ttcctattgttttttg
B D              Cow  ================
B D           Rabbit  ================
B D         Squirrel  ================
B D            Panda  ================
B D  Squirrel monkey  ================
B D          Manatee  ================
B D         Elephant  ================
B D       Guinea pig  ================
B D   Naked mole-rat  ================
B D         Marmoset  ================
B D           Gibbon  ================
B D     Nile tilapia  ================
B D         Microbat  ================
B D             Fugu  ================
B D     Atlantic cod  ================
B D           Medaka  ================
B D             Pika  ================
B D          Dolphin  ================
B D          Tarsier  ================
B D        Armadillo  ================
B D            Sheep  ================
B D       Budgerigar  ================
B D      Zebra finch  ================
B D           Lizard  ================
B D   Painted turtle  ================
B D          Chicken  ================
B D           Turkey  ================
B D              Cat  ================
B D            Shrew  ================
B D       Rock hyrax  ================
B D           Tenrec  ================
B D           Alpaca  ================
B D          Wallaby  ================
B D     Kangaroo rat  ================
B D       Coelacanth  ================
B D    X. tropicalis  ================
B D         Platypus  ================
B D  Tasmanian devil  ================
B D          Opossum  ================

Inserts between block 26 and 27 in window
B D           Human 4bp
B D           Chimp 4bp
B D         Gorilla 4bp
B D       Orangutan 4bp
B D          Rhesus 4bp
B D          Baboon 4bp
B D     Mouse lemur 4bp
B D        Bushbaby 4bp

Alignment block 27 of 516 in window, 115930760 - 115930761, 2 bps 
B D            Mouse  tc
B D              Rat  tc
B D           Rabbit  tc
B D            Human  tt
B D            Chimp  tt
B D          Gorilla  tt
B D        Orangutan  tt
B D           Rhesus  tt
B D           Baboon  tt
B D         Marmoset  tt
B D      Mouse lemur  gc
B D         Bushbaby  tc
B D              Pig  tt
B D              Dog  tt
B D            Horse  tt
B D          Megabat  tt
B D              Cow  ==
B D         Squirrel  ==
B D            Panda  ==
B D  Squirrel monkey  ==
B D          Manatee  ==
B D         Elephant  ==
B D       Guinea pig  ==
B D   Naked mole-rat  ==
B D           Gibbon  ==
B D     Nile tilapia  ==
B D         Microbat  ==
B D             Fugu  ==
B D     Atlantic cod  ==
B D           Medaka  ==
B D             Pika  ==
B D          Dolphin  ==
B D          Tarsier  ==
B D        Armadillo  ==
B D            Sheep  ==
B D       Budgerigar  ==
B D      Zebra finch  ==
B D           Lizard  ==
B D   Painted turtle  ==
B D          Chicken  ==
B D           Turkey  ==
B D              Cat  ==
B D            Shrew  ==
B D       Rock hyrax  ==
B D           Tenrec  ==
B D           Alpaca  ==
B D          Wallaby  ==
B D     Kangaroo rat  ==
B D       Coelacanth  ==
B D    X. tropicalis  ==
B D         Platypus  ==
B D  Tasmanian devil  ==
B D          Opossum  ==

Inserts between block 27 and 28 in window
B D             Pig 5bp
B D         Megabat 25bp

Alignment block 28 of 516 in window, 115930762 - 115930765, 4 bps 
B D            Mouse  tac---c
B D              Rat  tat---c
B D           Rabbit  tgt---c
B D            Human  tgtggtc
B D            Chimp  tgtggtc
B D          Gorilla  tgtggtc
B D        Orangutan  tgtggtc
B D           Rhesus  tgtggtc
B D           Baboon  tgtggtc
B D         Marmoset  tgtggtc
B D      Mouse lemur  tgtggcc
B D         Bushbaby  tatggcc
B D              Pig  ---ggcc
B D              Cat  ---tgcc
B D              Dog  ---tgtc
B D            Horse  ---t---
B D          Megabat  ---tacc
B D              Cow  =======
B D         Squirrel  =======
B D            Panda  =======
B D  Squirrel monkey  =======
B D          Manatee  =======
B D         Elephant  =======
B D       Guinea pig  =======
B D   Naked mole-rat  =======
B D           Gibbon  =======
B D     Nile tilapia  =======
B D         Microbat  =======
B D             Fugu  =======
B D     Atlantic cod  =======
B D           Medaka  =======
B D             Pika  =======
B D          Dolphin  =======
B D          Tarsier  =======
B D        Armadillo  =======
B D            Sheep  =======
B D       Budgerigar  =======
B D      Zebra finch  =======
B D           Lizard  =======
B D   Painted turtle  =======
B D          Chicken  =======
B D           Turkey  =======
B D            Shrew  =======
B D       Rock hyrax  =======
B D           Tenrec  =======
B D           Alpaca  =======
B D          Wallaby  =======
B D     Kangaroo rat  =======
B D       Coelacanth  =======
B D    X. tropicalis  =======
B D         Platypus  =======
B D  Tasmanian devil  =======
B D          Opossum  =======

Inserts between block 28 and 29 in window
B D             Cat 20bp
B D             Dog 291bp
B D           Horse 5bp

Alignment block 29 of 516 in window, 115930766 - 115930802, 37 bps 
B D            Mouse  cct---------gtaactgctactcagaagcatctttctcac---------------------------a
B D              Rat  ctg---------ataactactactcagaa-catctttctcat---------------------------a
B D           Rabbit  tct---------ct--ctgccactc-----tacctttcaaacaataaataaatctagaaagaaagaaaga
B D            Human  cct---------gtgccccct---------caccccacaaaa----------------------------
B D            Chimp  cct---------gtgccccct---------caccccacaaaa----------------------------
B D          Gorilla  cct---------gtgccccct---------caccccacaaaa----------------------------
B D        Orangutan  cct---------gtgccccct---------caccccacagaa----------------------------
B D           Rhesus  cct---------gtgccccct---------caccccacagaa----------------------------
B D           Baboon  cct---------gtgccccct---------caccccacagaa----------------------------
B D         Marmoset  cct---------gtgtcccca---------c-ccccacagaa----------------------------
B D      Mouse lemur  c---------------ccacc---------cgacccccggaa----------------------------
B D         Bushbaby  c---------------ccact---------ccacccctaggt----------------------------
B D              Pig  ---------------ctcact---------accccctcag------------------------------
B D              Cat  cctgtcagtgcagagccattc---------gcccccagaa------------------------------
B D            Horse  cctgtttgtg--gggcctcct---------gcccccaca-------------------------------
B D          Megabat  ctcgcatatg--ataccctgt---------aac-------------------------------------
B D              Cow  ======================================================================
B D         Squirrel  ======================================================================
B D            Panda  ======================================================================
B D  Squirrel monkey  ======================================================================
B D          Manatee  ======================================================================
B D         Elephant  ======================================================================
B D              Dog  ======================================================================
B D       Guinea pig  ======================================================================
B D   Naked mole-rat  ======================================================================
B D           Gibbon  ======================================================================
B D     Nile tilapia  ======================================================================
B D         Microbat  ======================================================================
B D             Fugu  ======================================================================
B D     Atlantic cod  ======================================================================
B D           Medaka  ======================================================================
B D             Pika  ======================================================================
B D          Dolphin  ======================================================================
B D          Tarsier  ======================================================================
B D        Armadillo  ======================================================================
B D            Sheep  ======================================================================
B D       Budgerigar  ======================================================================
B D      Zebra finch  ======================================================================
B D           Lizard  ======================================================================
B D   Painted turtle  ======================================================================
B D          Chicken  ======================================================================
B D           Turkey  ======================================================================
B D            Shrew  ======================================================================
B D       Rock hyrax  ======================================================================
B D           Tenrec  ======================================================================
B D           Alpaca  ======================================================================
B D          Wallaby  ======================================================================
B D     Kangaroo rat  ======================================================================
B D       Coelacanth  ======================================================================
B D    X. tropicalis  ======================================================================
B D         Platypus  ======================================================================
B D  Tasmanian devil  ======================================================================
B D          Opossum  ======================================================================

               Mouse  ggg
                 Rat  gg-
              Rabbit  gg-
               Human  ---
               Chimp  ---
             Gorilla  ---
           Orangutan  ---
              Rhesus  ---
              Baboon  ---
            Marmoset  ---
         Mouse lemur  ---
            Bushbaby  ---
                 Pig  ---
                 Cat  ---
               Horse  ---
             Megabat  ---
                 Cow  ===
            Squirrel  ===
               Panda  ===
     Squirrel monkey  ===
             Manatee  ===
            Elephant  ===
                 Dog  ===
          Guinea pig  ===
      Naked mole-rat  ===
              Gibbon  ===
        Nile tilapia  ===
            Microbat  ===
                Fugu  ===
        Atlantic cod  ===
              Medaka  ===
                Pika  ===
             Dolphin  ===
             Tarsier  ===
           Armadillo  ===
               Sheep  ===
          Budgerigar  ===
         Zebra finch  ===
              Lizard  ===
      Painted turtle  ===
             Chicken  ===
              Turkey  ===
               Shrew  ===
          Rock hyrax  ===
              Tenrec  ===
              Alpaca  ===
             Wallaby  ===
        Kangaroo rat  ===
          Coelacanth  ===
       X. tropicalis  ===
            Platypus  ===
     Tasmanian devil  ===
             Opossum  ===

Inserts between block 29 and 30 in window
B D           Human 1bp
B D           Chimp 1bp
B D         Gorilla 1bp
B D       Orangutan 1bp
B D          Rhesus 1bp
B D          Baboon 1bp
B D        Marmoset 19bp
B D     Mouse lemur 1bp
B D        Bushbaby 1bp
B D             Pig 12bp
B D             Cat 12bp

Alignment block 30 of 516 in window, 115930803 - 115930807, 5 bps 
B D            Mouse  tactg
B D              Rat  tgctg
B D           Rabbit  tgcag
B D            Human  cactg
B D            Chimp  cactg
B D          Gorilla  cactg
B D        Orangutan  cactg
B D           Rhesus  cattg
B D           Baboon  cattg
B D  Squirrel monkey  cactg
B D      Mouse lemur  tgctg
B D         Bushbaby  tgctg
B D              Pig  ggcag
B D              Cat  gagtg
B D            Horse  gaatg
B D          Megabat  gaata
B D              Cow  =====
B D         Squirrel  =====
B D            Panda  =====
B D          Manatee  =====
B D         Elephant  =====
B D              Dog  =====
B D       Guinea pig  =====
B D   Naked mole-rat  =====
B D         Marmoset  =====
B D           Gibbon  =====
B D     Nile tilapia  =====
B D         Microbat  =====
B D             Fugu  =====
B D     Atlantic cod  =====
B D           Medaka  =====
B D             Pika  =====
B D          Dolphin  =====
B D          Tarsier  =====
B D        Armadillo  =====
B D            Sheep  =====
B D       Budgerigar  =====
B D      Zebra finch  =====
B D           Lizard  =====
B D   Painted turtle  =====
B D          Chicken  =====
B D           Turkey  =====
B D            Shrew  =====
B D       Rock hyrax  =====
B D           Tenrec  =====
B D           Alpaca  =====
B D          Wallaby  =====
B D     Kangaroo rat  =====
B D       Coelacanth  =====
B D    X. tropicalis  =====
B D         Platypus  =====
B D  Tasmanian devil  =====
B D          Opossum  =====

Inserts between block 30 and 31 in window
B D             Pig 2bp
B D             Cat 12bp
B D           Horse 2bp
B D         Megabat 3bp

Alignment block 31 of 516 in window, 115930808 - 115930871, 64 bps 
B D            Mouse  gcttct-----------tgcat--ccagagtttt-------ttgtctccctcg---------------g-
B D              Rat  gcttct-----------tgcat--ccagtgctttc------ttgtctctctcg---------------g-
B D           Rabbit  gcatct-----------tgggg--gcaggggct--------tggtccttctga---------------at
B D            Human  gcttct-----------tgtga--gcaggagct--------tgctctttcgtgtaccctgtgt-----g-
B D            Chimp  gcttct-----------tgtga--gcaggagct--------tgctctttcgtgtaccctgtgt-----g-
B D          Gorilla  gcttct-----------tgtga--gcaggagct--------tgctctttcgtgtaccctgtgt-----a-
B D        Orangutan  gcttct-----------tgtga--gcaggagct--------tgctctttcgtgtaccctgtgt-----g-
B D           Rhesus  gcttct-----------tgtgg--gcaggagct--------tgctctttcatgtcccctgtgt-----g-
B D           Baboon  gcttct-----------tgtgg--gcaggagct--------tgctctttcatgtcccctgtgt-----g-
B D         Marmoset  ------------------------aagggagct--------tgctcttttgtgtcccccgagtggagac-
B D  Squirrel monkey  gctgct-----------tatgcgggagggaact--------tgctcttttgtgttccctgagt-----c-
B D      Mouse lemur  gcttct-----------tgcgg--gcagaggct--------tggtctctcttgtcccctgtgt-----g-
B D         Bushbaby  gcttcc-----------tgcac--ataggggct--------tggtctttcttggcccctatgt-----g-
B D              Pig  ------------------------------act--------tgggccttcttgcccactgt-------g-
B D              Cat  gcttccaaggcccactgtccca--gccc-agctgacacagacgtccccagatgtgccctgt-------g-
B D            Horse  acttcc-----------tgcca--gcag-ggct--------tgatccttcttgtccactgt-------g-
B D         Microbat  gcttcc-----------tgcag--gcaggggct--------tggtcctccttgtccattgt-------g-
B D          Megabat  -cttcc-----------tgaag--gcagaagct--------tggtccttcttgtccaacgt-------g-
B D              Cow  ======================================================================
B D         Squirrel  ======================================================================
B D            Panda  ======================================================================
B D          Manatee  ======================================================================
B D         Elephant  ======================================================================
B D              Dog  ======================================================================
B D       Guinea pig  ======================================================================
B D   Naked mole-rat  ======================================================================
B D           Gibbon  ======================================================================
B D     Nile tilapia  ======================================================================
B D             Fugu  ======================================================================
B D     Atlantic cod  ======================================================================
B D           Medaka  ======================================================================
B D             Pika  ======================================================================
B D          Dolphin  ======================================================================
B D          Tarsier  ======================================================================
B D        Armadillo  ======================================================================
B D            Sheep  ======================================================================
B D       Budgerigar  ======================================================================
B D      Zebra finch  ======================================================================
B D           Lizard  ======================================================================
B D   Painted turtle  ======================================================================
B D          Chicken  ======================================================================
B D           Turkey  ======================================================================
B D            Shrew  ======================================================================
B D       Rock hyrax  ======================================================================
B D           Tenrec  ======================================================================
B D           Alpaca  ======================================================================
B D          Wallaby  ======================================================================
B D     Kangaroo rat  ======================================================================
B D       Coelacanth  ======================================================================
B D    X. tropicalis  ======================================================================
B D         Platypus  ======================================================================
B D  Tasmanian devil  ======================================================================
B D          Opossum  ======================================================================

               Mouse  gcccccag-----aat-caaattcttcc------------tctgggac
                 Rat  gcccccag-----aat-caaatccttcc------------tctgggac
              Rabbit  gtccccag-----aac-ggaactcctta------------tctgggac
               Human  tccccaag-----gac-caagcaccttg------------tctgggcc
               Chimp  tccccaag-----gac-caagcaccttg------------tctgggcc
             Gorilla  tccccgag-----gac-caagcaccttg------------tctgggcc
           Orangutan  tcccccag-----gac-caagcaccttg------------tctgggcc
              Rhesus  tcccccag-----gac-aaagcaccttg------------tctgggcc
              Baboon  tcccccag-----gac-aaagcaccttg------------tctgggcc
            Marmoset  tcaggggg-----gacacaagcaccttg------------tctgggcc
     Squirrel monkey  tcccgcag-----gac-caagcgccttg------------tctgggcc
         Mouse lemur  tcccccag-----aac-cgagtgccttg------------tccgggac
            Bushbaby  tcccccag-----aat-ggaacaccttg------------cctgggac
                 Pig  tcccccag-----aac-tgagcccctcc-----atttacccctggaac
                 Cat  tgttgcagtgtccaac-c-agttctttt------------tctaggc-
               Horse  tgccctag-----aac-caagcactttg------------tttggaac
            Microbat  tctcccag-----aac-caagcaacttg-gtcgatacacatttgtggc
             Megabat  tcccctag-----aac-cgagtgacttacgttgatacatatttgcgtc
                 Cow  ================================================
            Squirrel  ================================================
               Panda  ================================================
             Manatee  ================================================
            Elephant  ================================================
                 Dog  ================================================
          Guinea pig  ================================================
      Naked mole-rat  ================================================
              Gibbon  ================================================
        Nile tilapia  ================================================
                Fugu  ================================================
        Atlantic cod  ================================================
              Medaka  ================================================
                Pika  ================================================
             Dolphin  ================================================
             Tarsier  ================================================
           Armadillo  ================================================
               Sheep  ================================================
          Budgerigar  ================================================
         Zebra finch  ================================================
              Lizard  ================================================
      Painted turtle  ================================================
             Chicken  ================================================
              Turkey  ================================================
               Shrew  ================================================
          Rock hyrax  ================================================
              Tenrec  ================================================
              Alpaca  ================================================
             Wallaby  ================================================
        Kangaroo rat  ================================================
          Coelacanth  ================================================
       X. tropicalis  ================================================
            Platypus  ================================================
     Tasmanian devil  ================================================
             Opossum  ================================================

Inserts between block 31 and 32 in window
B D             Cat 22bp
B D           Horse 240bp
B D        Microbat 26bp
B D         Megabat 114bp

Alignment block 32 of 516 in window, 115930872 - 115930876, 5 bps 
B D            Mouse  tcagt
B D              Rat  tcagt
B D           Rabbit  acagc
B D            Human  acagt
B D            Chimp  acagt
B D          Gorilla  acagt
B D        Orangutan  acagt
B D           Rhesus  acagt
B D           Baboon  acagt
B D         Marmoset  acagt
B D  Squirrel monkey  acagt
B D      Mouse lemur  acagt
B D         Bushbaby  acaac
B D              Pig  tcatc
B D              Cat  -ccca
B D         Microbat  -ctcc
B D          Megabat  -cctc
B D              Cow  =====
B D         Squirrel  =====
B D            Panda  =====
B D          Manatee  =====
B D         Elephant  =====
B D            Horse  =====
B D              Dog  =====
B D       Guinea pig  =====
B D   Naked mole-rat  =====
B D           Gibbon  =====
B D     Nile tilapia  =====
B D             Fugu  =====
B D     Atlantic cod  =====
B D           Medaka  =====
B D             Pika  =====
B D          Dolphin  =====
B D          Tarsier  =====
B D        Armadillo  =====
B D            Sheep  =====
B D       Budgerigar  =====
B D      Zebra finch  =====
B D           Lizard  =====
B D   Painted turtle  =====
B D          Chicken  =====
B D           Turkey  =====
B D            Shrew  =====
B D       Rock hyrax  =====
B D           Tenrec  =====
B D           Alpaca  =====
B D          Wallaby  =====
B D     Kangaroo rat  =====
B D       Coelacanth  =====
B D    X. tropicalis  =====
B D         Platypus  =====
B D  Tasmanian devil  =====
B D          Opossum  =====

Inserts between block 32 and 33 in window
B D             Pig 159bp
B D             Cat 1bp
B D        Microbat 1bp
B D         Megabat 1bp

Alignment block 33 of 516 in window, 115930877 - 115930937, 61 bps 
B D            Mouse  ggatgtttcac--acacgtatcggcctgacagtca-------tcctggagcatcctacac----------
B D              Rat  ggatgctccac--tcgtgtatcggcctgacagtca-------tcctggagcatccttcac----------
B D           Rabbit  cactgcgtgac--cctcatgctgg-ctgatggtca-------tcaccaagtgccacccacttc-------
B D            Human  aggtgctcaat--acacatgttggctggacagtgg-------tcactgagcggc-cgcacgtcgggcact
B D            Chimp  atgtgctcaat--acacatgttggctggacagtgg-------tcactgagcggc-cgcacgtcgggcact
B D          Gorilla  aggtgctcaat--acacatgttggctggacagtgg-------tcactgagtggc-cgcacgtcgggcact
B D        Orangutan  aggtgctcaat--acacacgttggctggacagtgg-------tcactgagcggc-tgcacgtcgggcact
B D           Rhesus  aggtgctcaat--acacatgttggctggatggtgg-------tccctgagcggc-cacacttcgggcatt
B D           Baboon  aggtgctcaat--acacatgttggctggatggtgg-------tccctgagcggc-cacacttcgggcact
B D         Marmoset  aggtgctcagt--gcacatgctggctggacggtgg-------tcactgagtggc-cgaacatcaggcact
B D  Squirrel monkey  aggtgctcaat--acacatgttggctggacggtgg-------tcactgagtggc-cacacatcaggcact
B D      Mouse lemur  aggtgctcgctagacacgtggtagctgggtgg-----------------------ctgtcatcgagcacc
B D         Bushbaby  aagtgctcagtacacacatgtgagctggatggtgg------------gagcagtcctgaccccgagcagc
B D              Cat  gcctgccttgc--tcac------ggcag--------------tgatctgg-----tgcctagcatgt---
B D         Microbat  agctacc-----------------------------------cccttta------ttcctaggaggtgtc
B D          Megabat  atttgccccgc--aaac--------ccgtcagtgccaagcctccatctggc--c-ctcctgggatccacc
B D              Pig  ======================================================================
B D              Cow  ======================================================================
B D         Squirrel  ======================================================================
B D            Panda  ======================================================================
B D          Manatee  ======================================================================
B D         Elephant  ======================================================================
B D            Horse  ======================================================================
B D              Dog  ======================================================================
B D       Guinea pig  ======================================================================
B D   Naked mole-rat  ======================================================================
B D           Gibbon  ======================================================================
B D     Nile tilapia  ======================================================================
B D             Fugu  ======================================================================
B D     Atlantic cod  ======================================================================
B D           Medaka  ======================================================================
B D             Pika  ======================================================================
B D          Dolphin  ======================================================================
B D          Tarsier  ======================================================================
B D        Armadillo  ======================================================================
B D            Sheep  ======================================================================
B D       Budgerigar  ======================================================================
B D      Zebra finch  ======================================================================
B D           Lizard  ======================================================================
B D   Painted turtle  ======================================================================
B D          Chicken  ======================================================================
B D           Turkey  ======================================================================
B D            Shrew  ======================================================================
B D       Rock hyrax  ======================================================================
B D           Tenrec  ======================================================================
B D           Alpaca  ======================================================================
B D          Wallaby  ======================================================================
B D     Kangaroo rat  ======================================================================
B D       Coelacanth  ======================================================================
B D    X. tropicalis  ======================================================================
B D         Platypus  ======================================================================
B D  Tasmanian devil  ======================================================================
B D          Opossum  ======================================================================

               Mouse  ------------------a---------------------------------------------------
                 Rat  ------------------a---------------------------------------------------
              Rabbit  ----c-----ctcctg--g---------------------------------------------------
               Human  ctcag-----cacttg-ca---------------------------------------------------
               Chimp  ctcag-----cacttg-ca---------------------------------------------------
             Gorilla  ctcag-----cacttg-ca---------------------------------------------------
           Orangutan  ctcag-----cacttg-ca---------------------------------------------------
              Rhesus  gtcag-----cacctg-ca---------------------------------------------------
              Baboon  gtcag-----cacctg-ca---------------------------------------------------
            Marmoset  ctcag-----cacctg-ca---------------------------------------------------
     Squirrel monkey  ctcag-----cacctg-ca---------------------------------------------------
         Mouse lemur  ccagg-----ca----------------------------------------------------------
            Bushbaby  ctggc-----tactt--cattcctagagggtgttgttgtcatgctctttgtgacgccgagggctgggaac
                 Cat  ----------cacctggca---------------------------------------------------
            Microbat  atcgca----ttcctgtca---------------------------------------------------
             Megabat  ctcatggggttacttttca---------------------------------------------------
                 Pig  ======================================================================
                 Cow  ======================================================================
            Squirrel  ======================================================================
               Panda  ======================================================================
             Manatee  ======================================================================
            Elephant  ======================================================================
               Horse  ======================================================================
                 Dog  ======================================================================
          Guinea pig  ======================================================================
      Naked mole-rat  ======================================================================
              Gibbon  ======================================================================
        Nile tilapia  ======================================================================
                Fugu  ======================================================================
        Atlantic cod  ======================================================================
              Medaka  ======================================================================
                Pika  ======================================================================
             Dolphin  ======================================================================
             Tarsier  ======================================================================
           Armadillo  ======================================================================
               Sheep  ======================================================================
          Budgerigar  ======================================================================
         Zebra finch  ======================================================================
              Lizard  ======================================================================
      Painted turtle  ======================================================================
             Chicken  ======================================================================
              Turkey  ======================================================================
               Shrew  ======================================================================
          Rock hyrax  ======================================================================
              Tenrec  ======================================================================
              Alpaca  ======================================================================
             Wallaby  ======================================================================
        Kangaroo rat  ======================================================================
          Coelacanth  ======================================================================
       X. tropicalis  ======================================================================
            Platypus  ======================================================================
     Tasmanian devil  ======================================================================
             Opossum  ======================================================================

               Mouse  ---------------------------gg------------------------ggccatc----------
                 Rat  ---------------------------gg------------------------ggtcctc----------
              Rabbit  ---------------------------gg------------------------tgtcacc----------
               Human  ---------------------------ca------------------------ggccgcc----------
               Chimp  ---------------------------ca------------------------ggccgcc----------
             Gorilla  ---------------------------ca------------------------ggccgcc----------
           Orangutan  ---------------------------ca------------------------ggccgcc----------
              Rhesus  ---------------------------ca------------------------ggccacc----------
              Baboon  ---------------------------ca------------------------ggccacc----------
            Marmoset  ---------------------------ca------------------------ggccacc----------
     Squirrel monkey  ---------------------------ca------------------------ggccacc----------
         Mouse lemur  ---------------------------cg------------------------ggccacc----------
            Bushbaby  cttccagtgtccagccttcatttgcccca------------------------ggtcatc----------
                 Cat  ---------------------------cac-----------------------agctgcct---------
            Microbat  ---------------------------cagatgaagggagcctatcaatatcaggcctccatttggtccc
             Megabat  ---------------------------cat-----------------------ggcatcca--aggt---
                 Pig  ======================================================================
                 Cow  ======================================================================
            Squirrel  ======================================================================
               Panda  ======================================================================
             Manatee  ======================================================================
            Elephant  ======================================================================
               Horse  ======================================================================
                 Dog  ======================================================================
          Guinea pig  ======================================================================
      Naked mole-rat  ======================================================================
              Gibbon  ======================================================================
        Nile tilapia  ======================================================================
                Fugu  ======================================================================
        Atlantic cod  ======================================================================
              Medaka  ======================================================================
                Pika  ======================================================================
             Dolphin  ======================================================================
             Tarsier  ======================================================================
           Armadillo  ======================================================================
               Sheep  ======================================================================
          Budgerigar  ======================================================================
         Zebra finch  ======================================================================
              Lizard  ======================================================================
      Painted turtle  ======================================================================
             Chicken  ======================================================================
              Turkey  ======================================================================
               Shrew  ======================================================================
          Rock hyrax  ======================================================================
              Tenrec  ======================================================================
              Alpaca  ======================================================================
             Wallaby  ======================================================================
        Kangaroo rat  ======================================================================
          Coelacanth  ======================================================================
       X. tropicalis  ======================================================================
            Platypus  ======================================================================
     Tasmanian devil  ======================================================================
             Opossum  ======================================================================

               Mouse  -----------------------------------------------------------
                 Rat  -----------------------------------------------------------
              Rabbit  -----------------------------------------------------------
               Human  -----------------------------------------------------------
               Chimp  -----------------------------------------------------------
             Gorilla  -----------------------------------------------------------
           Orangutan  -----------------------------------------------------------
              Rhesus  -----------------------------------------------------------
              Baboon  -----------------------------------------------------------
            Marmoset  -----------------------------------------------------------
     Squirrel monkey  -----------------------------------------------------------
         Mouse lemur  -----------------------------------------------------------
            Bushbaby  -----------------------------------------------------------
                 Cat  ---------------------------------------------------------cc
            Microbat  aaagctcgtcctgctattccgggacccacccttgtggggttccatggtatccaaagccc
             Megabat  ---------------------------------------------------------cc
                 Pig  ===========================================================
                 Cow  ===========================================================
            Squirrel  ===========================================================
               Panda  ===========================================================
             Manatee  ===========================================================
            Elephant  ===========================================================
               Horse  ===========================================================
                 Dog  ===========================================================
          Guinea pig  ===========================================================
      Naked mole-rat  ===========================================================
              Gibbon  ===========================================================
        Nile tilapia  ===========================================================
                Fugu  ===========================================================
        Atlantic cod  ===========================================================
              Medaka  ===========================================================
                Pika  ===========================================================
             Dolphin  ===========================================================
             Tarsier  ===========================================================
           Armadillo  ===========================================================
               Sheep  ===========================================================
          Budgerigar  ===========================================================
         Zebra finch  ===========================================================
              Lizard  ===========================================================
      Painted turtle  ===========================================================
             Chicken  ===========================================================
              Turkey  ===========================================================
               Shrew  ===========================================================
          Rock hyrax  ===========================================================
              Tenrec  ===========================================================
              Alpaca  ===========================================================
             Wallaby  ===========================================================
        Kangaroo rat  ===========================================================
          Coelacanth  ===========================================================
       X. tropicalis  ===========================================================
            Platypus  ===========================================================
     Tasmanian devil  ===========================================================
             Opossum  ===========================================================

Inserts between block 33 and 34 in window
B D             Rat 8bp
B D           Human 9bp
B D           Chimp 9bp
B D         Gorilla 9bp
B D       Orangutan 9bp
B D          Rhesus 9bp
B D          Baboon 9bp
B D        Marmoset 9bp
B D Squirrel monkey 9bp
B D     Mouse lemur 1710bp
B D        Bushbaby 32bp

Alignment block 34 of 516 in window, 115930938 - 115930957, 20 bps 
B D            Mouse  a----cagctgcatgtcagaaatg
B D              Rat  a----cagctacatggcagaga--
B D           Rabbit  a----t-gctgc-ttttggaggtg
B D            Human  -----ccacttcattcctgggagg
B D            Chimp  -----ccacttcattcctgggagg
B D          Gorilla  -----ccacttcattcctgggagg
B D        Orangutan  -----ccacttcattcctgggagg
B D           Rhesus  -----ccgcttcattcttaggagg
B D           Baboon  -----ccgcttcattcttaggagg
B D         Marmoset  -----ccacttcattcctaggagg
B D  Squirrel monkey  -----ccacttcattcctaggagg
B D         Bushbaby  acgggctacctgccacatagcatc
B D              Cat  ----tggatgcaaggc--------
B D         Microbat  ----actgtccaagcccagg----
B D          Megabat  ----actgtcccatcccagc----
B D              Pig  ========================
B D              Cow  ========================
B D         Squirrel  ========================
B D            Panda  ========================
B D          Manatee  ========================
B D         Elephant  ========================
B D            Horse  ========================
B D              Dog  ========================
B D       Guinea pig  ========================
B D   Naked mole-rat  ========================
B D           Gibbon  ========================
B D     Nile tilapia  ========================
B D             Fugu  ========================
B D     Atlantic cod  ========================
B D           Medaka  ========================
B D             Pika  ========================
B D          Dolphin  ========================
B D          Tarsier  ========================
B D        Armadillo  ========================
B D            Sheep  ========================
B D       Budgerigar  ========================
B D      Zebra finch  ========================
B D           Lizard  ========================
B D   Painted turtle  ========================
B D          Chicken  ========================
B D           Turkey  ========================
B D      Mouse lemur  ========================
B D            Shrew  ========================
B D       Rock hyrax  ========================
B D           Tenrec  ========================
B D           Alpaca  ========================
B D          Wallaby  ========================
B D     Kangaroo rat  ========================
B D       Coelacanth  ========================
B D    X. tropicalis  ========================
B D         Platypus  ========================
B D  Tasmanian devil  ========================
B D          Opossum  ========================

Alignment block 35 of 516 in window, 115930958 - 115930971, 14 bps 
B D            Mouse  ct-----------ggcctcac-atcc
B D              Rat  --------------------c-atcc
B D           Rabbit  ag-----------g------g-acct
B D            Human  tg-----------tcatcatg-ttgc
B D            Chimp  tg-----------tcatcatg-ttgc
B D          Gorilla  tg-----------tcatcatg-ttgc
B D        Orangutan  tg-----------tcatcatg-ttgc
B D           Rhesus  tgtcatcgtgttcc------------
B D           Baboon  tgtcatcgtgttcc------------
B D         Marmoset  tg-----------tcatcgtg-ttcc
B D  Squirrel monkey  tg-----------tcatcatg-ttcc
B D         Bushbaby  tg-----------agcccatg-tgac
B D         Microbat  ------------ctgaccaga-gtcc
B D          Megabat  ------------ctcagcagacatcc
B D              Pig  ==========================
B D              Cow  ==========================
B D         Squirrel  ==========================
B D            Panda  ==========================
B D          Manatee  ==========================
B D         Elephant  ==========================
B D            Horse  ==========================
B D              Dog  ==========================
B D       Guinea pig  ==========================
B D   Naked mole-rat  ==========================
B D           Gibbon  ==========================
B D     Nile tilapia  ==========================
B D             Fugu  ==========================
B D     Atlantic cod  ==========================
B D           Medaka  ==========================
B D             Pika  ==========================
B D          Dolphin  ==========================
B D          Tarsier  ==========================
B D        Armadillo  ==========================
B D            Sheep  ==========================
B D       Budgerigar  ==========================
B D      Zebra finch  ==========================
B D           Lizard  ==========================
B D   Painted turtle  ==========================
B D          Chicken  ==========================
B D           Turkey  ==========================
B D      Mouse lemur  ==========================
B D              Cat  --------------------------
B D            Shrew  ==========================
B D       Rock hyrax  ==========================
B D           Tenrec  ==========================
B D           Alpaca  ==========================
B D          Wallaby  ==========================
B D     Kangaroo rat  ==========================
B D       Coelacanth  ==========================
B D    X. tropicalis  ==========================
B D         Platypus  ==========================
B D  Tasmanian devil  ==========================
B D          Opossum  ==========================

Alignment block 36 of 516 in window, 115930972 - 115930989, 18 bps 
B D            Mouse  tcagacaccagg----------cct----agt
B D              Rat  ccagacaccagg----------cct----agt
B D           Rabbit  gccaacactgag----------cctccagggc
B D            Human  ttggacgacggggagagggggacctgcc-agt
B D            Chimp  ttggacgacggggagagggggacctgcc-agt
B D          Gorilla  ttggacgacggggagagggggacctgcc-agt
B D        Orangutan  ttggacagcggggagagagggacctgcc-agt
B D           Rhesus  ttggacagcggggagagggggacctgcc-agt
B D           Baboon  ttggacagcggggagagggggacctgcc-agt
B D         Marmoset  ttggatagcttgaagaggtagatct-------
B D  Squirrel monkey  ttggatggcttgaagagggagacct-------
B D         Bushbaby  t-------------------gaccacac-atc
B D              Pig  tccgagaccaca----------cttgct----
B D              Cat  ----------------------cttgct----
B D            Horse  ----------------------catacc----
B D         Microbat  -------ccaga----------catg-c----
B D          Megabat  -------tcaga----------catgcc----
B D              Cow  ================================
B D         Squirrel  ================================
B D            Panda  ================================
B D          Manatee  ================================
B D         Elephant  ================================
B D              Dog  ================================
B D       Guinea pig  ================================
B D   Naked mole-rat  ================================
B D           Gibbon  ================================
B D     Nile tilapia  ================================
B D             Fugu  ================================
B D     Atlantic cod  ================================
B D           Medaka  ================================
B D             Pika  ================================
B D          Dolphin  ================================
B D          Tarsier  ================================
B D        Armadillo  ================================
B D            Sheep  ================================
B D       Budgerigar  ================================
B D      Zebra finch  ================================
B D           Lizard  ================================
B D   Painted turtle  ================================
B D          Chicken  ================================
B D           Turkey  ================================
B D      Mouse lemur  ================================
B D            Shrew  ================================
B D       Rock hyrax  ================================
B D           Tenrec  ================================
B D           Alpaca  ================================
B D          Wallaby  ================================
B D     Kangaroo rat  ================================
B D       Coelacanth  ================================
B D    X. tropicalis  ================================
B D         Platypus  ================================
B D  Tasmanian devil  ================================
B D          Opossum  ================================

Inserts between block 36 and 37 in window
B D             Cat 27bp
B D           Horse 31bp
B D        Microbat 25bp
B D         Megabat 26bp

Alignment block 37 of 516 in window, 115930990 - 115931022, 33 bps 
B D            Mouse  gctgg---------------tcttcctca-gactg-gcgtccccagca-------gg--
B D              Rat  ccaggac------------ctcctcccca-ggttg-gcatccccagca-------gg--
B D           Rabbit  cctgatc------------atcaactcca-gactg-cctcccccagcgtcctgctgg--
B D            Human  gttggcctcca--------ttttccccca-gtcat-ctgcccccaa---------gg--
B D            Chimp  gttggcctcca--------tttgccccca-gtcat-ctgcccccaa---------gg--
B D          Gorilla  gttggcctcca--------tttgccccca-gtcat-ctgcccccaa---------gg--
B D        Orangutan  gttggcctcca--------tttgccccca-gccat-ctgcccccaa---------gg--
B D           Rhesus  gttggcctcca--------tttgccccca-gccat-ctgcctccaa---------gg--
B D           Baboon  gttggcctcca--------tttgccccca-gccat-ctgcccccaa---------gg--
B D         Marmoset  ----acctcca--------tttgcccccaggccat-ctgcccccaa---------gg--
B D  Squirrel monkey  ----acctcca--------tttgcccccaggccat-ctgcccccaa---------gg--
B D         Bushbaby  cctagacagca--------ctttgcct---gctgtgccacccaata---------gg--
B D              Pig  ------------------------gtgct-cattg-cag-----------------aga
B D              Cat  -------------------tctgctccaa-t----------------------------
B D              Dog  gctgggc------------tttgccttca-cattg-gag-tcccag---------gagg
B D            Horse  ccagggt-cca--------cctcccctta-cactg-act-ccccag---------gagg
B D         Microbat  cctgttt-ccagggtctgcctccccttca-cactg-gagtccccag---------gagg
B D          Megabat  cctgt--------------ctccccttca-cactg-gagtccccag---------gagg
B D              Cow  ===========================================================
B D         Squirrel  ===========================================================
B D            Panda  ===========================================================
B D          Manatee  ===========================================================
B D         Elephant  ===========================================================
B D       Guinea pig  ===========================================================
B D   Naked mole-rat  ===========================================================
B D           Gibbon  ===========================================================
B D     Nile tilapia  ===========================================================
B D             Fugu  ===========================================================
B D     Atlantic cod  ===========================================================
B D           Medaka  ===========================================================
B D             Pika  ===========================================================
B D          Dolphin  ===========================================================
B D          Tarsier  ===========================================================
B D        Armadillo  ===========================================================
B D            Sheep  ===========================================================
B D       Budgerigar  ===========================================================
B D      Zebra finch  ===========================================================
B D           Lizard  ===========================================================
B D   Painted turtle  ===========================================================
B D          Chicken  ===========================================================
B D           Turkey  ===========================================================
B D      Mouse lemur  ===========================================================
B D            Shrew  ===========================================================
B D       Rock hyrax  ===========================================================
B D           Tenrec  ===========================================================
B D           Alpaca  ===========================================================
B D          Wallaby  ===========================================================
B D     Kangaroo rat  ===========================================================
B D       Coelacanth  ===========================================================
B D    X. tropicalis  ===========================================================
B D         Platypus  ===========================================================
B D  Tasmanian devil  ===========================================================
B D          Opossum  ===========================================================

Inserts between block 37 and 38 in window
B D           Human 128bp
B D           Chimp 128bp
B D         Gorilla 128bp
B D       Orangutan 128bp
B D          Rhesus 172bp
B D          Baboon 243bp