Multiz Alignments of 124 insects
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 1353 in window, 826001 - 826395, 395 bps 
B D                D. melanogaster  c------gacgtgaaagaaacg---------------gctc----cggc-aaaatc-attaaaattt---
  D                    D. simulans  c------gacgtgaaagaaacg---------------gctc----cggc-gaaatc-attaaaattt---
B D                   D. sechellia  c------gacgtgaaagaaacg---------------gctc----cggc-gaaatc-attaaatttt---
                         D. erecta  c------gacgtgaaagaaacg---------------gctc----cggc-gaaatc-attaaaattt---
                         D. yakuba  c------gacgtgaaagaaacg---------------gctc----cggt-gaaatc-attaaaattt---
                     D. ficusphila  -------gacgtgaaagaaacg---------------gctc----cata-gaagta-at----atat---
                     D. eugracilis  c------gacgtgaaagaaacg---------------gctc----cggc-gaaatt-attaaaaatt---
                      D. biarmipes  c------gacgagagagaaacg---------------gctc----cggc-aaaatc-gttataaatt---
                        D. suzukii  a------gacgagaaagaaacg---------------gctc----cggc-aaaatc-gttataaatt---
                     D. takahashii  -------gacgtgagagaaacg---------------gctc----cggc-aaaatc-gttagaaatt---
                        D. elegans  c------ga-gtgaaagaaacg---------------gctc----cggc-aaaatc-attaaaaatt---
                       D. rhopaloa  c------ga-gtgaaagaaacg---------------gctc----cggc-gaaatc-attaaaaaat---
                         D_serrata  tcaatcgaataataaataaacgaaaggaatcggctgcgctc----cggc-gaaatc-attaaaaatt---
                       D. kikkawai  tcaatcgaataataaataaacg-aaggaatcggctgcgctc----cggc-gaaatc-attaaaaatt---
                      D. ananassae  a------gacg----gaagacg---------------gctc----cggc-gaaatc-gtcaaggatt---
                    D. bipectinata  a------gacg----gaagacg---------------gctc----cggc-gaaatc-gtcaaggatt---
                       D_americana  c------gacg---aagaagtt---------------gctc----cggt-aaaatt-gcctaaaat----
                    D_novamexicana  c------gacg---aagaagtt---------------gctc----cggt-aaaatt-gcctaaaat----
                        D. virilis  c------gacg---aagaagtg---------------gctc----cggt-aaaatt-gcctaaaat----
                        D_arizonae  c------gacg---aagaagta---------------gctc----cggt-aaaatt-gataaaaag----
                     D. mojavensis  c------gacg---aagaagta---------------gctc----cggt-aaaatt-gataaaaag----
                           D_hydei  c------aacg---aataagtg---------------gctc----cggt-aaaatt-gataaaaat----
                      D. grimshawi  c------gacg---aagaagtt---------------gctc----cggt-agaatt-gttaagaaa----
                       D_athabasca  c------gacgtacaaaaaacg---------------gttcgctccggt-aaaatc-attaaaaatt---
                 D_pseudoobscura_1  c------gacgtacaaaaaacg---------------gctcgctgcggt--aaatc-attaaaaatt---
                        D. miranda  c------gacgtacaaaaaacg---------------gctcgctgcggt--aaatc-attaaaagtt---
B D                  D. persimilis  c------gacgtacaaaaaacg---------------gctcgctgcggt--aaatc-attaaaaatt---
                  D. pseudoobscura  c------gacgtacaaaaaacg---------------gctcgctgcggt--aaatc-attaaaaatt---
                      D_subobscura  -------gacgtataaaaaacg---------------gctc----cggt-aaaatc-attaaaaattaaa
                         D_obscura  c------gacttctaaaaaacg---------------gctc----cggtaaaaaaa-attaaaaattaaa
                Zaprionus_indianus  c------gacg---aaaaagta---------------gctc----cggt--aaatctgctaaaaa-----
                          D_nasuta  c------gacg---aagaagtt---------------gctc----cggt-aaaact-gcttaaaaa----
                     D. albomicans  c------gacg---aagaagtt---------------gctc----cggt-aaaact-gcttagaaa----
                    D. willistoni  ======================================================================
                     A_arabiensis  ======================================================================
        Proctacanthus_coquilletti  ======================================================================
                Bactrocera_tryoni  ======================================================================
               Belgica_antarctica  ======================================================================
            Culicoides_sonorensis  ======================================================================
                     A. mellifera  ======================================================================
            Lutzomyia_longipalpis  ======================================================================
               Chironomus_tentans  ======================================================================
                        A_farauti  ======================================================================
              Stomoxys_calcitrans  ======================================================================
                 Bactrocera_oleae  ======================================================================
               Ceratitis_capitata  ======================================================================
                  Lucilia_cuprina  ======================================================================
             Bactrocera_latifrons  ======================================================================
              Bactrocera_dorsalis  ======================================================================
            Zeugodacus_cucurbitae  ======================================================================
                     M. domestica  ======================================================================
               Teleopsis_dalmanni  ======================================================================
    Scaptodrosophila_lebanonensis  ======================================================================
                     T. castaneum  ======================================================================
                 Ephydra_gracilis  ======================================================================
               Paykullia_maculata  ======================================================================
                        D_montana  ======================================================================

                   D. melanogaster  --aattag--ttaac---cgcaaga-gagcgctg-caaaattgtgcaaaca--------atttgc-cact
                       D. simulans  --aattag--ttaac---cgcaagg-gagcgctg-caaaattgtgcaaaca--------atttgc-cact
                      D. sechellia  --aattag--ttaac---cgcaagg-gagcgctg-caaaattgtgcaaaca--------atttgc-cact
                         D. erecta  --aattag--ttaac---cgcaagg-gagcgctg-caaaattgtgcaaaca--------atttgc-cact
                         D. yakuba  --aattag--ttaac---cgcaagg-gattgctg-caaaattgtgcaaaca--------atttgc-cact
                     D. ficusphila  --aa--------------------------------aaaactctgcaaacacttcgggtattagc-aatt
                     D. eugracilis  --aattag--ttaac---cgcaaat-cagccctg-caaaagtgtgcaaata--------actcgg-ccaa
                      D. biarmipes  --aattaa--taaac---cgcgaat-aggcactg-caaaagtgtgcaaaac--------aaccgc-tgat
                        D. suzukii  --aattaa--taaac---cgcaaat-cagcgctg-caaaagtgtgcaaaac--------acccgc-taat
                     D. takahashii  --aattaa--ttaac---cgcaaat-cagcgctg-ccaaagtgtgcaagcc--------aaccgc-taat
                        D. elegans  --aattaa--ttaac---cgcaaat-cagcgctc-caaaagtgtgcaaaca--------actcgg-tatt
                       D. rhopaloa  --aattaa--tttac---cgcaaat-cagcgctg-caaaagtgtgcgaaca--------actcgg-tagc
                         D_serrata  --aattgg--aaaac---cgtaaaaccagcgctc-aaaaagtgtataacca--------gctggt-aaat
                       D. kikkawai  --aattga--aaaac---cgcaaaaccagcgccg-aaaaagtgtgtaacca--------gctgga-aaat
                      D. ananassae  --aa-------gaac---cggaatc-gta-------aaaagtat-taacca--------gcccgc-t---
                    D. bipectinata  --aa-------caac---cggaatc-gta-------aaaagtat-taaaca--------gcccgc-t---
                       D_americana  --tattaa--tcaaa---cgcgaaa-taattctt-agaaataactgaattg--------catacatttaa
                    D_novamexicana  --tattaa--tcaaa---cgcgaaa-taattctt-agaaataactgaattg--------catacattgaa
                        D. virilis  --tattaa--tcaaa---cgcgaaa-taattctt-agaaattgttgaattg--------catacattgaa
                        D_arizonae  --agttgt--tcgac---cgcgaaa-taattctt-agaaattattgaattg--------cattcattaaa
                     D. mojavensis  --agttgt--tcgac---cgcgaaa-taattctt-agaaattattgaattg--------cattcattaaa
                           D_hydei  --tattgt--ccacc---cgcgaaa-taattcta-agaaattattacattg--------cgttcatcgaa
                      D. grimshawi  --agtgataatcaaa---cgcggat-tattgcttcaaaagttattaaa-tg--------cattaattaaa
                       D_athabasca  --tattaa--taatt---cgcgaat-cagtgctt-caaaagtgttaaatcg--------cttcaa-taat
                 D_pseudoobscura_1  --aattaa--taatt---cgcgaat-cagtgctt-caaaagtgtttaatag--------tctcaa-taat
                        D. miranda  --aattaa--taatg----gcgaat-cagtgctt-caaaagtgttaaatcg--------cctcaa-taat
                     D. persimilis  --aattaa--taatt---cgcgaat-cagtgctt-caaaagtgtttaatag--------tctcaa-taat
                  D. pseudoobscura  --aattaa--taatt---cgcgaat-cagtgctt-caaaagtgtttaatag--------tctcaa-taat
                      D_subobscura  tgaattaa--taatt---tgcg-----agtgctt--aaaagtgttcattcg--------cctcta-taat
                         D_obscura  tgaattaa--taatt---cggaa----agtgttt--aaaagtgtttaaccg--------tctcaa-taat
                Zaprionus_indianus  --aattaa--taattaaacgcggat-aactgctt-ggaaattatttaattg--------cgcgaattgat
                          D_nasuta  --aattga--taatttaacgcgaaa-tcttactt-aaaaagtattcaattg--------cattcactaaa
                     D. albomicans  --aattga--taatttaacgcgaaa-tcttactt-aaaaagtattcaattg--------cattcactaaa
                     D. willistoni  ======================================================================
                      A_arabiensis  ======================================================================
         Proctacanthus_coquilletti  ======================================================================
                 Bactrocera_tryoni  ======================================================================
                Belgica_antarctica  ======================================================================
             Culicoides_sonorensis  ======================================================================
                      A. mellifera  ======================================================================
             Lutzomyia_longipalpis  ======================================================================
                Chironomus_tentans  ======================================================================
                         A_farauti  ======================================================================
               Stomoxys_calcitrans  ======================================================================
                  Bactrocera_oleae  ======================================================================
                Ceratitis_capitata  ======================================================================
                   Lucilia_cuprina  ======================================================================
              Bactrocera_latifrons  ======================================================================
               Bactrocera_dorsalis  ======================================================================
             Zeugodacus_cucurbitae  ======================================================================
                      M. domestica  ======================================================================
                Teleopsis_dalmanni  ======================================================================
     Scaptodrosophila_lebanonensis  ======================================================================
                      T. castaneum  ======================================================================
                  Ephydra_gracilis  ======================================================================
                Paykullia_maculata  ======================================================================
                         D_montana  ======================================================================

                   D. melanogaster  t---aa-cgcagttaacgtgtgcggtaatcagaagcgtggaaaagcgttt-attt-----------gt-c
                       D. simulans  t---aa-cgcagttaacgtgtgcggtaatcagaagcgtggtaaagcgttt-attt-----------gc-c
                      D. sechellia  t---aa-cgcagttaacgtgtgcggtaatcagaagcgtggtaaagcgttt-attt-----------gc-c
                         D. erecta  t---aa-cgtagttaacgtgtgcggtgatcagaagcgtggaaaagcgttt-attt-----------gc-c
                         D. yakuba  a---aa-cgtagttaacgtgtgcggtgatcagaagcgttaaaaagcgttt-attt-----------gc-g
                     D. ficusphila  a---tt-tgtaattaacgcgtgcggtattcagtggcctgggaaatagttg-tttt-----------tc-c
                     D. eugracilis  t---aa-agtaattatctcgtgccgtgatcagaagtttgaaaaatcat---atta-----------acgc
                      D. biarmipes  t---aa-cggaa-taacgcttgcggtgctcaggagcctggaaaatcgtta-gttg-----------gc-c
                        D. suzukii  t---aa-cgtaa-taacgcttgcggtgcttaggagcctggaaaatcgtta-gttt-----------gc-c
                     D. takahashii  c---at-cgtagctaaagcgtgtggtgtttgagagcccggaaaattgctc--ttt-----------tc-c
                        D. elegans  a---aa-agtaattaacgcgtgcggttattagaggactcgaaaatcgtta-aatt-----------cc-c
                       D. rhopaloa  t---aa-agcaattaacgcgtgaggtgatcagaccgctggaaaatcgtta-attt-----------tc-c
                         D_serrata  t---aa-tcaatttgtcgcgtttaacgctc-gcatagccaaaactcgtgt-tttt-----------ccgt
                       D. kikkawai  t---agcccaaagtgtcgcgttcaacgctc-gcatagccgaaactcgtgg-tttt-----------acgt
                      D. ananassae  -------ggcac------cgcgcagagccc---------gaaaagagtcg-agtg-----------cc-c
                    D. bipectinata  -------ggcac------cgcgaagagccc---------gagaagagtcg-agtg-----------tt-c
                       D_americana  t---gt-agcgtagtgcggttgcgtcattaacaacaaacgaaaagtgtca-aatacaagcataaa-----
                    D_novamexicana  t---gt-agcgtagtgcggttgcgtcattaacaacaaacgaaaagtgtca-aatacaagcataaa-----
                        D. virilis  t---gt-aacgtagtgcggttgcgtcattaacagcaaacgaaaagtgtca-aatacaagcataaa-----
                        D_arizonae  t---ac-ctcgaagtgcggttgcgtcattaacgacaaacgaaaagtgttg-aacaaaaacataaacgt-c
                     D. mojavensis  t---ac-ctcgaagtacggttgcgtcattaacgataaacgaaaagtgttgaaaaaaaaacataaacgt-c
                           D_hydei  t---gc-atcgaagtgcggttgcgtcattaactacaatcgaaaagtgtca-aatacaagcataaacgt-t
                      D. grimshawi  t---gc-acaaaagtgcgctggcgtcctaagtaacacacgaaaagtgtcaaaagtgaaaagtaaaagt-t
                       D_athabasca  t---gc-actaattatcctgtgcattgtcggtattaagcggaaagtgtcg-gagta----------gt-t
                 D_pseudoobscura_1  t---gc-actaattatcgtgtgcattgtcggtgttaagtaaaaagtgttg-aatta----------gt-t
                        D. miranda  ttaagc-aataataa-----------------gttaagcaaaaagtgttg-aatta----------gt-t
                     D. persimilis  t---gc-actaattatcgtgtgcattgtcggtgttaagtaaaaactgttg-aatta----------gt-t
                  D. pseudoobscura  t---gc-actaattatcgtgtgcattgtcggtgttaagtaaaaagtgttg-aatta----------gt-t
                      D_subobscura  t---gc-actaattatcgtgtgcattgtcggtgttaagcgaaaagtgttg-aattc----------gt-t
                         D_obscura  t---gc-actaattatcgtgtgcattgtcgggttaaatcgaaaagtgtcg-aatta----------gt-t
                Zaprionus_indianus  t---gc-gttaaagtgcggttgca-aaactatatgaatcaaaaagtctcg-aattaaatgaatatcgt-a
                          D_nasuta  t---gc-actaaagtgcggttgcgtt-ctaattcgatacggaaagggtac-aaattcaagaaaatcgt-t
                     D. albomicans  t---gc-aataaagtgcggttgcgtt-ctaattcgatacggaaagtgtac-aaattcaagaaaatcgt-t
                     D. willistoni  ======================================================================
                      A_arabiensis  ======================================================================
         Proctacanthus_coquilletti  ======================================================================
                 Bactrocera_tryoni  ======================================================================
                Belgica_antarctica  ======================================================================
             Culicoides_sonorensis  ======================================================================
                      A. mellifera  ======================================================================
             Lutzomyia_longipalpis  ======================================================================
                Chironomus_tentans  ======================================================================
                         A_farauti  ======================================================================
               Stomoxys_calcitrans  ======================================================================
                  Bactrocera_oleae  ======================================================================
                Ceratitis_capitata  ======================================================================
                   Lucilia_cuprina  ======================================================================
              Bactrocera_latifrons  ======================================================================
               Bactrocera_dorsalis  ======================================================================
             Zeugodacus_cucurbitae  ======================================================================
                      M. domestica  ======================================================================
                Teleopsis_dalmanni  ======================================================================
     Scaptodrosophila_lebanonensis  ======================================================================
                      T. castaneum  ======================================================================
                  Ephydra_gracilis  ======================================================================
                Paykullia_maculata  ======================================================================
                         D_montana  ======================================================================

                   D. melanogaster  aggatttgtgtg--tt-ttt-caatc---gcggca--gcagc--------atatgtacacac---acaca
                       D. simulans  aggatttgtgtg--tt-ttt-caatc---gcggca--gcagc--------atatgtacacac---acaca
                      D. sechellia  aggatttgtgtg--tt-ttt-caatc---gcggca--gcagc--------atatgtacacac---acaca
                         D. erecta  aggatttgtgtg--tt-ttt-caatc---gcggca--gcagc--------atatgtacacac---acaca
                         D. yakuba  aagatttgtgtg--tt-ttt-caatc---gcggca--gcagc--------atatgtacacac---acaca
                     D. ficusphila  acgattactgtg--tt-tttccaacc---gccgca--gcagc--------atatgtacacac---acata
                     D. eugracilis  aggatttgtgtgcttt-ttt-caatc---gcc-----gcagc--------atatgtacacac---acaca
                      D. biarmipes  aggatttgtgtg--tt-tttccaatc-----------gcagc--------atatgtacacac---acaca
                        D. suzukii  aggatttgtgtg--tt-ttttcaatc---gccgca--gcagc--------atatgtacacac---acaca
                     D. takahashii  gtattgcgagtg--tt-ttttcaatc---gccgca--gcagc--------atatgtacacac---acaca
                        D. elegans  aggatttgtgtg--tt-tttccactc---gccgca--gcagc--------atatgtacacac---acaca
                       D. rhopaloa  aggatttgtgtg--tt-ttttcactc---gccgca--gaagc--------atatgt--acac---acaca
                         D_serrata  gcgtttcgcgtg--at-ttt-ccatc---gcagca--gaagc--------atatgtacacaa---ccaca
                       D. kikkawai  gcaattcaagtg--at-ttt-ccatcgcagcagca--gcagc--------atatgtacacac---tcaca
                      D. ananassae  cgaggccgtgtg--tcattttccatt----ccggattgcagc--------attggtacgtgca--acccg
                    D. bipectinata  cgagcccgtgtg--tt-ttttccact----ccgga--gcagc--------ataggtacatgca--acccg
                       D_americana  --------agtg--at-ttt-caacg---ggc-ca--gcgta--------ttatatatat----------
                    D_novamexicana  --------agtg--at-ttt-caacg---agc-ca--gcgta--------ttatatatat----------
                        D. virilis  --------agtg--at-ttt-caacg---ggc-ca--gcgca--------ttatatatat----------
                        D_arizonae  tg-tacccagtg--at-ttt-cgact---gcc-ca--acata--------atatatatagat-atatata
                     D. mojavensis  tg-tacccagtg--at-ttt-cgact---gcc-ca--acata--------atatatatag---atatata
                           D_hydei  tg-tacccagtg--at-ttt-cgact---ggc-ca--gcata--------atatatatagat-atatata
                      D. grimshawi  tg-agccgactg--at-ttt-caact---ggc-ca--gcata--------atatatatat----------
                       D_athabasca  tgctttcgtgtg--tt-ttt-cgacc---gcctta--gcagc--------atatgtacatacaatacaca
                 D_pseudoobscura_1  tgctttcgtgtg--tt-ttt-cgacc---gcctta--gcagc--------atatgtacatacaatacaca
                        D. miranda  tgctttcgtgtg--tt-ttt-cgacc---gcctta--gcagc--------atatgtacatacaatacaca
                     D. persimilis  tgctctcgtgtg--tt-ttt-cgacc---gcctca--gcagc--------atatgtacatacaatacaca
                  D. pseudoobscura  tgctttcgtgtg--tt-ttt-cgacc---gcctta--gcagc--------atatgtacatacaatacaca
                      D_subobscura  tgcttttgtgtg--tt-ttt-cgacc---gcccta--gcagc--------atatgtacatacaatacaca
                         D_obscura  tgaattcgtgtg---c-ttt-cgacc---gcctca--gcagc--------atatgtacatacaatacaca
                Zaprionus_indianus  tg-ttttgtgtg--at-ttt-caact---gt------gcagc--------ataatt--------tataca
                          D_nasuta  ag-ttttgtgta--at-ttt-catct---ggg-ca--gcatacataatatacatatacgtacaatacata
                     D. albomicans  ag-ttttgtgta--at-ttt-catct---ggg-ca--gcatacataatatacatatacgtacaatacata
                     D. willistoni  ======================================================================
                      A_arabiensis  ======================================================================
         Proctacanthus_coquilletti  ======================================================================
                 Bactrocera_tryoni  ======================================================================
                Belgica_antarctica  ======================================================================
             Culicoides_sonorensis  ======================================================================
                      A. mellifera  ======================================================================
             Lutzomyia_longipalpis  ======================================================================
                Chironomus_tentans  ======================================================================
                         A_farauti  ======================================================================
               Stomoxys_calcitrans  ======================================================================
                  Bactrocera_oleae  ======================================================================
                Ceratitis_capitata  ======================================================================
                   Lucilia_cuprina  ======================================================================
              Bactrocera_latifrons  ======================================================================
               Bactrocera_dorsalis  ======================================================================
             Zeugodacus_cucurbitae  ======================================================================
                      M. domestica  ======================================================================
                Teleopsis_dalmanni  ======================================================================
     Scaptodrosophila_lebanonensis  ======================================================================
                      T. castaneum  ======================================================================
                  Ephydra_gracilis  ======================================================================
                Paykullia_maculata  ======================================================================
                         D_montana  ======================================================================

                   D. melanogaster  --g--------gctcacc-----c-----------ccg-ccccactcacacaca----------------
                       D. simulans  --c--------gctcacc-----c-----------ccg-ccccactcacacaaa----------------
                      D. sechellia  --c--------gctcacc-----c-----------ccg-ccccactcacacaaa----------------
                         D. erecta  --c--------gctcacc-----c-----------ccg-ccccactcacacaca----------------
                         D. yakuba  --c--------gctcacc-----c-----------ccg-ccccactcacacaca----------------
                     D. ficusphila  ctc--------gcgcacc-----c-----------ccg-ccccacacacacaca----------------
                     D. eugracilis  --a--------gcgcacc-----c-----------ccg-ccccactcacacaca----------------
                      D. biarmipes  --c--------gcgcacc-----c-----------ccg-ccca------acaca----------------
                        D. suzukii  --c--------gcgcacc-----c-----------ccg-cccaac----acaca----------------
                     D. takahashii  --c--------gcgcacc-----c-----------ccg-cccaac----ataca----------------
                        D. elegans  --c--------gcgcacc-----c-----------ccg-ccccaaacacacaca----------------
                       D. rhopaloa  --c--------gcgcacc-----c-----------ccg-ccccaa----acaca----------------
                         D_serrata  --c--------tcgcagt-----cgcacacgcacacca-ccccagtccgccgtg----------------
                       D. kikkawai  --c--------tcacact-----cgcacacgcacacca-ccccagtccgccgtg----------------
                      D. ananassae  --t--------gcacaca-----c-----------acg-cacctc----cgaca----------------
                    D. bipectinata  --t--------gcacaca-----c-----------acg-cacctccgaacgaca----------------
                       D_americana  -----------------------------------aca--catacagacgaaca----------------
                    D_novamexicana  -----------------------------------aca--catacagacgaaca----------------
                        D. virilis  -----------------------------------aca--catacagacgaaca----------------
                        D_arizonae  --a--------gtatata-----t-----------ata--catacatatgaaca----------------
                     D. mojavensis  --a--------gtatata-----t-----------ata--catacatacgaaca----------------
                           D_hydei  --aatatatatgtatata-----t-----------ata--catacatacgaaca----------------
                      D. grimshawi  -----------------------------------------acacacactaaca----------------
                       D_athabasca  --c--------acacacacagatc-----------ata-tcatacataaaggca----------------
                 D_pseudoobscura_1  --cacaag--cacacacacacatc-----------ata-tcatacataaaggct----tacatacatcca
                        D. miranda  --cacaag---acacacacacatc-----------ata-tcatacataaaggcttacatacatacataca
                     D. persimilis  --cacaagcacacacacacacatc-----------ata-tcatacataaaggct--------tacataca
                  D. pseudoobscura  --cacaagcacacacaca-----c-----------ata-tcatacataaaggct----tacatacataca
                      D_subobscura  --c--------acacaca---------------------tcatacataaagagg----------------
                         D_obscura  --c--------acacacacatact---------------tcatacataaagagg--actacataaatcca
                Zaprionus_indianus  --c--------actcacagcagtc-----------gcactcatacaaacgaaca----------------
                          D_nasuta  --cgt------gcatacaacagac-----------aga--ctcacacacgaaca----------------
                     D. albomicans  --cgc------gcatacaacagac-----------aga--ctcacacacgaaca----------------
                     D. willistoni  ======================================================================
                      A_arabiensis  ======================================================================
         Proctacanthus_coquilletti  ======================================================================
                 Bactrocera_tryoni  ======================================================================
                Belgica_antarctica  ======================================================================
             Culicoides_sonorensis  ======================================================================
                      A. mellifera  ======================================================================
             Lutzomyia_longipalpis  ======================================================================
                Chironomus_tentans  ======================================================================
                         A_farauti  ======================================================================
               Stomoxys_calcitrans  ======================================================================
                  Bactrocera_oleae  ======================================================================
                Ceratitis_capitata  ======================================================================
                   Lucilia_cuprina  ======================================================================
              Bactrocera_latifrons  ======================================================================
               Bactrocera_dorsalis  ======================================================================
             Zeugodacus_cucurbitae  ======================================================================
                      M. domestica  ======================================================================
                Teleopsis_dalmanni  ======================================================================
     Scaptodrosophila_lebanonensis  ======================================================================
                      T. castaneum  ======================================================================
                  Ephydra_gracilis  ======================================================================
                Paykullia_maculata  ======================================================================
                         D_montana  ======================================================================

                   D. melanogaster  cacactcac------gcct-aggt------------------gtattata-at--ta------------a
                       D. simulans  cacactctc------agct-aggt------------------gtattata-at--ta------------a
                      D. sechellia  cacactcac------agct-aggt------------------gtattata-at--ta------------a
                         D. erecta  cacactaac------ggct-aggt------------------gtattata-at--ta------------a
                         D. yakuba  cacactaac------ggct-aggt------------------gtattata-at--ta------------a
                     D. ficusphila  --------c------ggat-aggt------------------gtattata-at--ta------------a
                     D. eugracilis  tgtactcgc------ggat-aggt------------------gtattata-at--ta------------a
                      D. biarmipes  cacatacac------ggct-aggt------------------gtattaaa-at--ta------------a
                        D. suzukii  cacatacac------ggct-aggt------------------gtattaaa-at--ta------------a
                     D. takahashii  cacacacacacacttggct-aggt------------------gtattaaa-at--ta------------a
                        D. elegans  cacacactc------ggaa-atatatatatg-tatatatataatattata-at--ta------------a
                       D. rhopaloa  cacacactc------ggat-aggt------------------gtattata-at--ta------------a
                         D_serrata  tatatacat------ctgt-aggt----gcgttatgtacaaagtattata-attata------------a
                       D. kikkawai  tatatacat------ctgt-aggt----gcgttatgtacaaagtattata-attata------------a
                      D. ananassae  cacacatac---------t-aggt----gcgttgtgcgga--gtatt-ta-at--ta------------t
                    D. bipectinata  cacacatac---------t-aggt----gcgttgtgcgga--gtatt-ta-at--ta------------t
                       D_americana  gatgtacac------att--atgt------------------acatttaa-tg--ca---ttattattat
                    D_novamexicana  gatgtacac------ata--atgt------------------acatttaa-tg--ca---ttattattat
                        D. virilis  gatgtatac------ata--atgt------------------acatttaa-tg--ca---ttattaatat
                        D_arizonae  gatgtacac------ata--atgt------------------acacttaa-ag--ta------------g
                     D. mojavensis  gatgtacac------ata--atgt------------------acacttaa-ag--ta------------a
                           D_hydei  gatgtacac------ata--atgt------------------acatttaa-ag--ta-------------
                      D. grimshawi  gatgtacac------ata--atgt------------------acatttaa-ag--tattagtattattat
                       D_athabasca  tacatacat------atgt-acgt------------------acatcggagag--ta-------------
                 D_pseudoobscura_1  tacatacat------atgt-tcgc------------------acatcggagag--ta-------------
                        D. miranda  tacatacat------atgt-tcgc------------------acatcggagag--ta-------------
                     D. persimilis  tacatacat------atgt-tcgc------------------acatcggagag--ta-------------
                  D. pseudoobscura  tacatacat------atgt-tcgc------------------acatcggagag--ta-------------
                      D_subobscura  --aatacat------acat-ccat------------------acatcggagag--ta-------------
                         D_obscura  tacatacaa------atgt-acgt------------------acatcggagag--ta-------------
                Zaprionus_indianus  gatgtacac------ata--atgt------------------acatttga-ag--ca-------------
                          D_nasuta  gatgtacac------acataatgt------------------acttttaa-ag--tg----------tat
                     D. albomicans  gatgtacac------acataatgt------------------acttttaa-ag--tg----------tat
                     D. willistoni  ======================================================================
                      A_arabiensis  ======================================================================
         Proctacanthus_coquilletti  ======================================================================
                 Bactrocera_tryoni  ======================================================================
                Belgica_antarctica  ======================================================================
             Culicoides_sonorensis  ======================================================================
                      A. mellifera  ======================================================================
             Lutzomyia_longipalpis  ======================================================================
                Chironomus_tentans  ======================================================================
                         A_farauti  ======================================================================
               Stomoxys_calcitrans  ======================================================================
                  Bactrocera_oleae  ======================================================================
                Ceratitis_capitata  ======================================================================
                   Lucilia_cuprina  ======================================================================
              Bactrocera_latifrons  ======================================================================
               Bactrocera_dorsalis  ======================================================================
             Zeugodacus_cucurbitae  ======================================================================
                      M. domestica  ======================================================================
                Teleopsis_dalmanni  ======================================================================
     Scaptodrosophila_lebanonensis  ======================================================================
                      T. castaneum  ======================================================================
                  Ephydra_gracilis  ======================================================================
                Paykullia_maculata  ======================================================================
                         D_montana  ======================================================================

                   D. melanogaster  agtt----gtg-tttt-----------aagtgt-gt--gt----aa--agtgc---------aa------
                       D. simulans  agtt----gtg-tttt-----------aagtgt-gt--gt----aa--agtgc---------aa------
                      D. sechellia  agtt----gtg-tttt-----------aagtgt-gt--gt----aa--agtgc---------aa------
                         D. erecta  agtt----gtg-tttt-----------aagtgt-gt--gt----aa--agtgc---------aa------
                         D. yakuba  agtt----gtg-tttc-----------aagtgt-gt--gt----aa--agtgc---------aa------
                     D. ficusphila  agtt----gtgctttt-----------aagtgt-gt--gt----aa--agtgc---------aa------
                     D. eugracilis  agtt----gtg-tttta----------aagtgt-gt--gt----aa--agtgc---------aa------
                      D. biarmipes  agtt----gtg-ttttc----------gagtgt-gt--gt----aa--agtgc---------aa------
                        D. suzukii  agtt----gtg-ttttc----------gagtgt-gt--gt----aa--agtgc---------aa------
                     D. takahashii  agtt----gtgtttttc----------gagtgt-gt--gt----aa--agtgc---------aa------
                        D. elegans  agtt----gtg-tttta----------aagtgt-gtgcgt----aa--agtgc---------aa------
                       D. rhopaloa  agtt----gtg-tttta----------aagtgt-gt--gt----aa--agtgc---------aa------
                         D_serrata  aatt----gca-agtgaacccaagtgtgtgtgt-gt--gtgtgaaa--agtgc---------aa------
                       D. kikkawai  aatt----gca-agtgagcccaagagtgtgtgt-gt--gt----aa--agtgc---------aa------
                      D. ananassae  aatttcgagtg-tgca-----------gagtgt-gt--gt----aa--agtgc---------aa------
                    D. bipectinata  aatttcgagtg-tgca-----------gcgtgt-gt--gt----aa--agtgc---------aa------
                       D_americana  tatt----aat-atagt----------gaacgt-at--gt----ta--agtga---------ga------
                    D_novamexicana  tatt----agt-atagt----------gaacgt-at--gt----ta--agtga---------ga------
                        D. virilis  tatt----agt-atagt----------gaacgt-at--gt----ta--agtga---------ca------
                        D_arizonae  tctt----att-acagt----------gaacga-gt--gt----ta--agtgc---------aa------
                     D. mojavensis  tatt----att-acagt----------gaacga-gt--gt----ta--agtgc---------aa------
                           D_hydei  --tt----att-acagt----------gaacgg-gt--gt----ta--agtgc---------aa------
                      D. grimshawi  tatt----atc-attgt----------gagagt-gt--gt----ga--agagtgcaatacaaaa------
                       D_athabasca  --tt----ata-attat----------aatcgt-gt--gt----aa--agtgc---------aataccct
                 D_pseudoobscura_1  --tt----ata-attat----------aatcgt-gt--gt----aa--agtgc---------aataccct
                        D. miranda  --tt----ata-attat----------aatcgt-gt--gt----aa--agtgc---------aataccct
                     D. persimilis  --tt----ata-attat----------aatcgt-gt--gt----aa--agtgc---------aataccct
                  D. pseudoobscura  --tt----ata-attat----------aatcgt-gt--gt----aa--agtgc---------aataccct
                      D_subobscura  --tt----ata-attgt----------aatcgt-gt--gt----aa--agtgc---------aataccct
                         D_obscura  --tt----ata-attat----------aatcgt-gt--gt----aa--agtgc---------aataccct
                Zaprionus_indianus  --tt----att-attattgtg------gaacct-gt--gt----aa--agtgc---------aatacact
                          D_nasuta  tatt----att-attgt----------gaacgtcgt--gt----aaagagtgc---------aa------
                     D. albomicans  tatt----att-attgt----------gaacgtcgt--gt----aaagagtgc---------aa------
                     D. willistoni  ======================================================================
                      A_arabiensis  ======================================================================
         Proctacanthus_coquilletti  ======================================================================
                 Bactrocera_tryoni  ======================================================================
                Belgica_antarctica  ======================================================================
             Culicoides_sonorensis  ======================================================================
                      A. mellifera  ======================================================================
             Lutzomyia_longipalpis  ======================================================================
                Chironomus_tentans  ======================================================================
                         A_farauti  ======================================================================
               Stomoxys_calcitrans  ======================================================================
                  Bactrocera_oleae  ======================================================================
                Ceratitis_capitata  ======================================================================
                   Lucilia_cuprina  ======================================================================
              Bactrocera_latifrons  ======================================================================
               Bactrocera_dorsalis  ======================================================================
             Zeugodacus_cucurbitae  ======================================================================
                      M. domestica  ======================================================================
                Teleopsis_dalmanni  ======================================================================
     Scaptodrosophila_lebanonensis  ======================================================================
                      T. castaneum  ======================================================================
                  Ephydra_gracilis  ======================================================================
                Paykullia_maculata  ======================================================================
                         D_montana  ======================================================================

                   D. melanogaster  ----tagc---c--------------------------------------------cagtgg--------
                       D. simulans  ----tagc---c--------------------------------------------cagtgg--------
                      D. sechellia  ----tagc---c--------------------------------------------cagtgg--------
                         D. erecta  ----tagc---c--------------------------------------------cagtgg--------
                         D. yakuba  ----tagc---c--------------------------------------------cagtgg--------
                     D. ficusphila  ----tagc---c--------------------------------------------cagtga--------
                     D. eugracilis  ----tagc---c--------------------------------------------cagtgg--------
                      D. biarmipes  ----tagc---c--------------------------------------------cagtgg--------
                        D. suzukii  ----tagc---c--------------------------------------------cagtgg--------
                     D. takahashii  ----tagc---c--------------------------------------------gagtgg--------
                        D. elegans  ----tagc---c--------------------------------------------cagtgg--------
                       D. rhopaloa  ----tagc---c--------------------------------------------cagtgg--------
                         D_serrata  ----tagc---cggggcggagagttccgagtggagtgtgtg---------------cggtgg--------
                       D. kikkawai  ----tagc---ctgggcggagagttcggagcggagtgtgtg---------------cggtgg--------
                      D. ananassae  ----tagc---c--------------------------------------------tggcga--------
                    D. bipectinata  ----tagc---c--------------------------------------------tggcga--------
                       D_americana  -aaataga------------------------------------------------gtttggcaagcgcc
                    D_novamexicana  -aaataga------------------------------------------------gtttggcaagcgcc
                        D. virilis  -aaataga------------------------------------------------gtttggcaagcgcc
                        D_arizonae  -atttagt------------------------------------------------gtgtgg--------
                     D. mojavensis  -atatagt------------------------------------------------gtgtgg--------
                           D_hydei  -atttact------------------------------------------------gtttgg--------
                      D. grimshawi  -atttggt---t---------------------------ggcaaacgcctaaaaacatttgg--------
                       D_athabasca  ggattaca---t---------------------------ta---------------ttgctg--------
                 D_pseudoobscura_1  ggattaca---t---------------------------tg---------------gtgctgcaagta--
                        D. miranda  ggattaca---t---------------------------tg---------------gtgctgcaagta--
                     D. persimilis  ggattaca---t---------------------------tg---------------gtgctgcaagta--
                  D. pseudoobscura  ggattaca---t---------------------------tg---------------gtgctgcaagta--
                      D_subobscura  ggatt--a---t---------------------------ta---------------gtgctg--------
                         D_obscura  ggattaca--------------------------------g---------------ctgctg--------
                Zaprionus_indianus  ttggcaagcgcc---------------------------tg---------------gaactg--------
                          D_nasuta  ----taca---c---------------------------tt---------------ttgcta--------
                     D. albomicans  ----taca---c---------------------------tt---------------ttgtta--------
                     D. willistoni  ======================================================================
                      A_arabiensis  ======================================================================
         Proctacanthus_coquilletti  ======================================================================
                 Bactrocera_tryoni  ======================================================================
                Belgica_antarctica  ======================================================================
             Culicoides_sonorensis  ======================================================================
                      A. mellifera  ======================================================================
             Lutzomyia_longipalpis  ======================================================================
                Chironomus_tentans  ======================================================================
                         A_farauti  ======================================================================
               Stomoxys_calcitrans  ======================================================================
                  Bactrocera_oleae  ======================================================================
                Ceratitis_capitata  ======================================================================
                   Lucilia_cuprina  ======================================================================
              Bactrocera_latifrons  ======================================================================
               Bactrocera_dorsalis  ======================================================================
             Zeugodacus_cucurbitae  ======================================================================
                      M. domestica  ======================================================================
                Teleopsis_dalmanni  ======================================================================
     Scaptodrosophila_lebanonensis  ======================================================================
                      T. castaneum  ======================================================================
                  Ephydra_gracilis  ======================================================================
                Paykullia_maculata  ======================================================================
                         D_montana  ======================================================================

                   D. melanogaster  ---aaag---------------------tgg---------aa--gtgatataga---------gtgcgtt
                       D. simulans  ---aaag---------------------tgg---------aa--gtgaaataga---------gtgcgtt
                      D. sechellia  ---aaag---------------------tgg---------aa--gtgaaataga---------gtgc---
                         D. erecta  ---aaag---------------------tgg---------aa--gtgaaataga---------gtgcgtt
                         D. yakuba  ---aaag---------------------tgg---------aa--gtgaaataga---------gtgcgtt
                     D. ficusphila  ---aaag---------------------tgg---------aa--gtgaaat--a---------gtgcgtt
                     D. eugracilis  ---aaag---------------------tgg---------aa--gtgaaataga---------gtgcgtt
                      D. biarmipes  ---aaag---------------------tgg---------aa--gtgaaataga---------gtgcgtt
                        D. suzukii  ---aaag---------------------tgg---------aa--gtgaaataga---------gtgcgtt
                     D. takahashii  ---aaag---------------------tgg---------aa--gtgaaatagaaatagaaacaggagtt
                        D. elegans  ---aaag---------------------tgg---------aa--gtgaaataga---------gtgtggt
                       D. rhopaloa  ---aaag---------------------tgg---------aa--gtgaaataga-----------gtggt
                         D_serrata  ---agag---------------------tggaaaacagtaaa--gtgaagtaaa---------gtgcgcg
                       D. kikkawai  ---agag---------------------tggagaaaagcaaa--gtgaagtgaa---------gtgcgcg
                      D. ananassae  ---aagcaggagccagagac--------tgg---------cagtgtgaagtgca---------gtgc---
                    D. bipectinata  ---aagcaggagccagagccagagccagagg---------ca--gtgaagtgca---------gtgc---
                       D_americana  tgcaaaa---------------------cat---------tt--gaatatcatt---------cgcagtt
                    D_novamexicana  tgcaaaa---------------------cat---------tt--gaatatcatt---------cgcagtt
                        D. virilis  tgcaaaa---------------------cat---------tt--gaatatcatt---------cgcagtt
                        D_arizonae  ---caag---------------------tgc---------ct--gaaaaacatt----------------
                     D. mojavensis  ---cagg---------------------cgc---------ct--gaaaaagatt----------------
                           D_hydei  ---caag---------------------cgc---------ct--gaaaaacatt----------------
                      D. grimshawi  ---caaaaaatcttgtt-----------cgc---------ag--taaaagtgaa----------------
                       D_athabasca  ---caag---------------------tgc---------aa--gtgcagctgc---------cggagcc
                 D_pseudoobscura_1  ---caag---------------------tgc---------aa--gtgcagctgc---------cggagcc
                        D. miranda  ---caag---------------------tgc---------aa--gtgcagctgc---------cggagcc
                     D. persimilis  ---caag---------------------tgc---------aa--gtgcagctgc---------cggagcc
                  D. pseudoobscura  ---caag---------------------tgc---------aa--gtgcagctgc---------cggagcc
                      D_subobscura  ---caag---------------------tgc---------aa--gtgcagctgc---------ctgagcc
                         D_obscura  ---caag---------------------tgc---------aa--gtgcagctgc---------cggatcc
                Zaprionus_indianus  ----------------------------tgc---------aa--atattgttg--------------gca
                          D_nasuta  ---aaat---------------------ttt---------ga--atattgttt--------------gct
                     D. albomicans  ---aaat---------------------ttt---------ga--atattgttt--------------gct
                     D. willistoni  ======================================================================
                      A_arabiensis  ======================================================================
         Proctacanthus_coquilletti  ======================================================================
                 Bactrocera_tryoni  ======================================================================
                Belgica_antarctica  ======================================================================
             Culicoides_sonorensis  ======================================================================
                      A. mellifera  ======================================================================
             Lutzomyia_longipalpis  ======================================================================
                Chironomus_tentans  ======================================================================
                         A_farauti  ======================================================================
               Stomoxys_calcitrans  ======================================================================
                  Bactrocera_oleae  ======================================================================
                Ceratitis_capitata  ======================================================================
                   Lucilia_cuprina  ======================================================================
              Bactrocera_latifrons  ======================================================================
               Bactrocera_dorsalis  ======================================================================
             Zeugodacus_cucurbitae  ======================================================================
                      M. domestica  ======================================================================
                Teleopsis_dalmanni  ======================================================================
     Scaptodrosophila_lebanonensis  ======================================================================
                      T. castaneum  ======================================================================
                  Ephydra_gracilis  ======================================================================
                Paykullia_maculata  ======================================================================
                         D_montana  ======================================================================

                   D. melanogaster  cc-aggagttccagg---------ag-c----------------agt---gtc-------ttat------
                       D. simulans  cc-aggagttccagg---------ag-c----------------agt---gtc-------ttag------
                      D. sechellia  -------gttccagg---------ag-c----------------agt---gtc-------ttag------
                         D. erecta  cc-aggagttccagg---------ag-c----------------agt---gtc-------ttag------
                         D. yakuba  cc-aggagttccagg---------ag-c----------------agt---gtc-------ttag------
                     D. ficusphila  cc-aggagctccagg---------agtt----------------agt---gtc---------aa------
                     D. eugracilis  cc-aggagtt----g---------ag-t----------------atc---gtc-------ttaa------
                      D. biarmipes  cc-a---ggtccagg----caaggag-ttcccttccaggagttgagt---gtg-------ctaa------
                        D. suzukii  cc-a---gttccagg----caaggag-ttcccttccaggagttgagt---gtc-------ttaa------
                     D. takahashii  cc-a---gttccagg----caaggag-tttcc--------------c---gtc-------ttaa------
                        D. elegans  -------gttccaggagttccagcag-tt------------ttgagtgtcgtc-------ttaa------
                       D. rhopaloa  -------gttccagg---------ag-tt------------ttgagt---gtc-------ttaa------
                         D_serrata  gc-gct-g-tccagg---------ag-c----------------ttc---ata-------ttca------
                       D. kikkawai  gc-gct-gctccagg---------ag-a----------------ttc---ata-------ttca------
                      D. ananassae  -------------gg---------gg-c-----------------ga---atc-------ct--------
                    D. bipectinata  -------------gg---------gg-c-----------------ga---atc-------ct--------
                       D_americana  ---gagtgaagaaag---------tg-c----------------att----tt-------tatatg----
                    D_novamexicana  ---gagtgaagaaag---------tg-c----------------att----tt-------tatatg----
                        D. virilis  ---aagtgaagaaag---------tg-c----------------att----tt-------tatatg----
                        D_arizonae  ----------ggaa-------------t----------------att---gct-------cgga------
                     D. mojavensis  ----------ggaa-------------t----------------att---gtt-------cgga------
                           D_hydei  ----------ggaa-------------t----------------att---gtt-------cgca------
                      D. grimshawi  ----------gaaag---------tg-c----------------att---ttt-------tatatg----
                       D_athabasca  ac-aaggaaagaaag---------tg-a----------------agt---ctg-------tacc------
                 D_pseudoobscura_1  gc-taggaaagaaag---------tg-a----------------agt---ctc-------tacc------
                        D. miranda  gc-aaggaaagaaag---------tg-a----------------agt---ctc-------tacc------
                     D. persimilis  gc-taggaaagaaag---------tg-a----------------agt---ctc-------tacc------
                  D. pseudoobscura  gc-aaggaaagaaag---------tg-a----------------agt---ctc-------tacc------
                      D_subobscura  gcaaaggaaagaaag---------tg-a----------------agt---ctc-------ctcc------
                         D_obscura  gc-aaggaaagaaag---------tg-a----------------agt---ctc-------ctcc------
                Zaprionus_indianus  gc-aagtgaagaaag---------tg-c----------------aat---tttacatgagtgtt------
                          D_nasuta  gc-gtgtgaagaaag---------tg-c----------------att----tt-------tacatgagtg
                     D. albomicans  gc-gtgtgaagaaag---------tg-c----------------att----tt-------tacatgagtg
                     D. willistoni  ======================================================================
                      A_arabiensis  ======================================================================
         Proctacanthus_coquilletti  ======================================================================
                 Bactrocera_tryoni  ======================================================================
                Belgica_antarctica  ======================================================================
             Culicoides_sonorensis  ======================================================================
                      A. mellifera  ======================================================================
             Lutzomyia_longipalpis  ======================================================================
                Chironomus_tentans  ======================================================================
                         A_farauti  ======================================================================
               Stomoxys_calcitrans  ======================================================================
                  Bactrocera_oleae  ======================================================================
                Ceratitis_capitata  ======================================================================
                   Lucilia_cuprina  ======================================================================
              Bactrocera_latifrons  ======================================================================
               Bactrocera_dorsalis  ======================================================================
             Zeugodacus_cucurbitae  ======================================================================
                      M. domestica  ======================================================================
                Teleopsis_dalmanni  ======================================================================
     Scaptodrosophila_lebanonensis  ======================================================================
                      T. castaneum  ======================================================================
                  Ephydra_gracilis  ======================================================================
                Paykullia_maculata  ======================================================================
                         D_montana  ======================================================================

                   D. melanogaster  --cccatg-------tcttc--cactcccaaa-------t------cctg--a---ggatt---gccaag
                       D. simulans  --cccatg-------tcttc--cactcccaaa-------t------cctg--a---ggatt---gccaag
                      D. sechellia  --cccatg-------tcttc--cactcccaaa-------t------cctg--a---ggatt---gccaag
                         D. erecta  --cccatg-------tcttc--ctgtcccaaa-------t------cctg--a---ggatt---gctaag
                         D. yakuba  --cccacg-------tcttc--ccgacccaaa-------t------cctg--a---ggatt---gccaag
                     D. ficusphila  --cccatg-------tcttc--ccgttcgccagtggcttt------tcga--a---gggctggggctaag
                     D. eugracilis  --cccatg-------tcttc--ccgttccgat-------t------gctg--g-----------gttaag
                      D. biarmipes  --cccatg-------tcatccgcgactcccgt-------t------gcca--a---ggctt---gctgag
                        D. suzukii  --cccatg-------tcttccccgattcccat-------t------gcca--a---ggatt---gctaag
                     D. takahashii  --cccatg-------tcttc---------------------------cta--a---ggatt---tccccg
                        D. elegans  --cacacatgtcttcccatttgctgctggctt-------t------tcca--a---gggctggtgctaag
                       D. rhopaloa  --cacatg-----tcccgttcgctgctggctt-------t------tcca--a---gggctggggctaag
                         D_serrata  --tccatt-------gccatgtctggtcaaag-------g------gctgctg---gggcc---gctggc
                       D. kikkawai  --tccgtt-------gccatgtctggtcaaag-------g------gctgctg---gggcc---gctggc
                      D. ananassae  ---------------cctcc-------------------a------tcca--acctgggctgg-gccgct
                    D. bipectinata  ---------------ccatt-------------------a------gcga--a---gggctgg-gccgct
                       D_americana  --gtcgct-------tctgc-------------------t------gctg--c-----------acaaag
                    D_novamexicana  --gtcgct-------tctgc-------------------t------gctg--c-----------acaaag
                        D. virilis  --gtccct-------tctgc-------------------t------gctg--c-----------acaaag
                        D_arizonae  ----------------------------------------------gttc--a-----------gtga--
                     D. mojavensis  ----------------------------------------------gttc--a-----------gtga--
                           D_hydei  ----------------------------------------------gtta--a-----------gtga--
                      D. grimshawi  --gtcgct-------gctgc-------------------cgctgctgctg--c-----------acaa--
                       D_athabasca  --ttcgat-------gccga-------------------c------gccg-ac-----------gaaagg
                 D_pseudoobscura_1  ---------------gccga-------------------t------gccg-ac-----------gaaagg
                        D. miranda  ---------------gccga-------------------t------gccg-ac-----------gaaagg
                     D. persimilis  ---------------gccga-------------------t------gccg-ac-----------gaaagg
                  D. pseudoobscura  ---------------gccga-------------------t------gccg-ac-----------gaaagg
                      D_subobscura  ---------------gccga-------------------t------gccg-ac-----------gaaagg
                         D_obscura  ---------------gccga-------------------t------gccg-tc-----------gcaagg
                Zaprionus_indianus  ---------------tctgc-------------------t------gctg--c-----------acaaag
                          D_nasuta  cttctact-------gctgc-------------------t------gctt--c-----------acaaag
                     D. albomicans  cttctgct-------gctgc-------------------t------gctt--c-----------acaaag
                     D. willistoni  ======================================================================
                      A_arabiensis  ======================================================================
         Proctacanthus_coquilletti  ======================================================================
                 Bactrocera_tryoni  ======================================================================
                Belgica_antarctica  ======================================================================
             Culicoides_sonorensis  ======================================================================
                      A. mellifera  ======================================================================
             Lutzomyia_longipalpis  ======================================================================
                Chironomus_tentans  ======================================================================
                         A_farauti  ======================================================================
               Stomoxys_calcitrans  ======================================================================
                  Bactrocera_oleae  ======================================================================
                Ceratitis_capitata  ======================================================================
                   Lucilia_cuprina  ======================================================================
              Bactrocera_latifrons  ======================================================================
               Bactrocera_dorsalis  ======================================================================
             Zeugodacus_cucurbitae  ======================================================================
                      M. domestica  ======================================================================
                Teleopsis_dalmanni  ======================================================================
     Scaptodrosophila_lebanonensis  ======================================================================
                      T. castaneum  ======================================================================
                  Ephydra_gracilis  ======================================================================
                Paykullia_maculata  ======================================================================
                         D_montana  ======================================================================

                   D. melanogaster  ggtta---------agaccg
                       D. simulans  ggtta---------agaccg
                      D. sechellia  ggtta---------agaccg
                         D. erecta  ggtta---------aggctg
                         D. yakuba  ggtta---------aggctc
                     D. ficusphila  ggtta---------agggct
                     D. eugracilis  gattg---------aggata
                      D. biarmipes  ggttg---------aggctc
                        D. suzukii  ggtta---------aggctc
                     D. takahashii  gataa-------------ca
                        D. elegans  ggtta---------aggatt
                       D. rhopaloa  ggtta---------aggatt
                         D_serrata  tgcta---------gggcaa
                       D. kikkawai  tgcta---------gggcaa
                      D. ananassae  ggctacaaggcataaggact
                    D. bipectinata  ggcta-----tacaaggact
                       D_americana  ggctg---------gggccg
                    D_novamexicana  ggctg---------gggccg
                        D. virilis  ggctg---------gggccg
                        D_arizonae  --------------------
                     D. mojavensis  --------------------
                           D_hydei  --------------------
                      D. grimshawi  --------------------
                       D_athabasca  ggctg---------gggccg
                 D_pseudoobscura_1  ggctg---------gggccg
                        D. miranda  ggctg---------gggccg
                     D. persimilis  ggctg---------gggccg
                  D. pseudoobscura  ggctg---------gggccg
                      D_subobscura  ggctg---------gggccg
                         D_obscura  ggctg---------gggccg
                Zaprionus_indianus  ggctg---------gggccg
                          D_nasuta  ggctg---------gggccg
                     D. albomicans  ggctg---------gggccg
                     D. willistoni  ====================
                      A_arabiensis  ====================
         Proctacanthus_coquilletti  ====================
                 Bactrocera_tryoni  ====================
                Belgica_antarctica  ====================
             Culicoides_sonorensis  ====================
                      A. mellifera  ====================
             Lutzomyia_longipalpis  ====================
                Chironomus_tentans  ====================
                         A_farauti  ====================
               Stomoxys_calcitrans  ====================
                  Bactrocera_oleae  ====================
                Ceratitis_capitata  ====================
                   Lucilia_cuprina  ====================
              Bactrocera_latifrons  ====================
               Bactrocera_dorsalis  ====================
             Zeugodacus_cucurbitae  ====================
                      M. domestica  ====================
                Teleopsis_dalmanni  ====================
     Scaptodrosophila_lebanonensis  ====================
                      T. castaneum  ====================
                  Ephydra_gracilis  ====================
                Paykullia_maculata  ====================
                         D_montana  ====================

Inserts between block 1 and 2 in window
                       D_arizonae 2bp
                    D. mojavensis 2bp
                          D_hydei 2bp
                     D. grimshawi 90bp
               Zaprionus_indianus 76bp

Alignment block 2 of 1353 in window, 826396 - 826396, 1 bps 
B D                D. melanogaster  -a
  D                    D. simulans  -a
B D                   D. sechellia  -a
                         D. erecta  -a
                         D. yakuba  -a
                     D. ficusphila  -g
                     D. eugracilis  -a
                      D. biarmipes  -g
                        D. suzukii  -g
                     D. takahashii  -g
                        D. elegans  -g
                       D. rhopaloa  -g
                         D_serrata  -g
                       D. kikkawai  -g
                      D. ananassae  -c
                    D. bipectinata  -c
                       D_athabasca  c-
                 D_pseudoobscura_1  c-
                        D. miranda  c-
B D                  D. persimilis  c-
                  D. pseudoobscura  c-
                      D_subobscura  c-
                         D_obscura  c-
                    D. willistoni  ==
                     D. grimshawi  ==
                       D_arizonae  ==
                    D. mojavensis  ==
                       D. virilis  --
                   D_novamexicana  --
                    D. albomicans  --
                         D_nasuta  --
                     A_arabiensis  ==
        Proctacanthus_coquilletti  ==
                Bactrocera_tryoni  ==
               Belgica_antarctica  ==
            Culicoides_sonorensis  ==
                     A. mellifera  ==
            Lutzomyia_longipalpis  ==
               Chironomus_tentans  ==
                        A_farauti  ==
              Stomoxys_calcitrans  ==
                 Bactrocera_oleae  ==
               Ceratitis_capitata  ==
                  Lucilia_cuprina  ==
             Bactrocera_latifrons  ==
              Bactrocera_dorsalis  ==
            Zeugodacus_cucurbitae  ==
                      D_americana  --
                     M. domestica  ==
                          D_hydei  ==
               Teleopsis_dalmanni  ==
               Zaprionus_indianus  ==
    Scaptodrosophila_lebanonensis  ==
                     T. castaneum  ==
                 Ephydra_gracilis  ==
               Paykullia_maculata  ==
                        D_montana  ==

Alignment block 3 of 1353 in window, 826397 - 826451, 55 bps 
B D                D. melanogaster  gaaatacgg-actcc------gactttccggataa----ggata--------------------------
  D                    D. simulans  gaaatactg-actcc------gacttcccggataa----ggata--------------------------
B D                   D. sechellia  gaaatactg-actcc------gacttcccggataa----ggata--------------------------
                         D. erecta  gaaatacgg-tctag------gacttcccggataa----ggata--------------------------
                         D. yakuba  gaaatacgg-tctcg------gactttccggataa----ggata--------------------------
                     D. ficusphila  aggatacgg-actcg------gactcgccggatag---cggata--------------------------
                     D. eugracilis  gaag--------tcg------cattgcctggatag---cggata--------------------------
                      D. biarmipes  aggataagg--cacg-------------------------gata--------------------------
                        D. suzukii  aggataagg-acacg-------------------------gata--------------------------
                     D. takahashii  aggataggg--------------------------------ata--------------------------
                        D. elegans  aggataagg-acaca-------------cggatag---cggata--------------------------
                       D. rhopaloa  aggataaag-acacggagacggattcgccggatag---cggata--------------------------
                         D_serrata  ctagaggat-tctcg-----------------cca---cggata--------------------------
                       D. kikkawai  caagtggatatctcg-----------------cca---cggata--------------------------
                      D. ananassae  ggcataagg-actcc------acacagccacataggctcggata--------------------------
                    D. bipectinata  ggcataagg-act--------------ccacataggcccggata--------------------------
                       D_americana  ----------------------------------------------------------------------
                    D_novamexicana  ----------------------------------------------------------------------
                        D. virilis  ----------------------------------------------------------------------
                        D_arizonae  -----------------------------------------aaagtgcattttt----------atatgg
                     D. mojavensis  -----------------------------------------aaagtgcattttt----------atatgg
                           D_hydei  -----------------------------------------aaagtgcatttttatatggtcgc------
                       D_athabasca  ----------------------------------------------------------------------
                 D_pseudoobscura_1  ----------------------------------------------------------------------
                        D. miranda  ----------------------------------------------------------------------
B D                  D. persimilis  ----------------------------------------------------------------------
                  D. pseudoobscura  ----------------------------------------------------------------------
                      D_subobscura  ----------------------------------------------------------------------
                         D_obscura  ----------------------------------------------------------------------
                          D_nasuta  ---------------------------------------------------------------------t
                     D. albomicans  ---------------------------------------------------------------------t
                    D. willistoni  ======================================================================
                     D. grimshawi  ======================================================================
                     A_arabiensis  ======================================================================
        Proctacanthus_coquilletti  ======================================================================
                Bactrocera_tryoni  ======================================================================
               Belgica_antarctica  ======================================================================
            Culicoides_sonorensis  ======================================================================
                     A. mellifera  ======================================================================
            Lutzomyia_longipalpis  ======================================================================
               Chironomus_tentans  ======================================================================
                        A_farauti  ======================================================================
              Stomoxys_calcitrans  ======================================================================
                 Bactrocera_oleae  ======================================================================
               Ceratitis_capitata  ======================================================================
                  Lucilia_cuprina  ======================================================================
             Bactrocera_latifrons  ======================================================================
              Bactrocera_dorsalis  ======================================================================
            Zeugodacus_cucurbitae  ======================================================================
                     M. domestica  ======================================================================
               Teleopsis_dalmanni  ======================================================================
               Zaprionus_indianus  ======================================================================
    Scaptodrosophila_lebanonensis  ======================================================================
                     T. castaneum  ======================================================================
                 Ephydra_gracilis  ======================================================================
               Paykullia_maculata  ======================================================================
                        D_montana  ======================================================================

                   D. melanogaster  cggatacg----gat---------aaggagtg-cca
                       D. simulans  cggatacg----gat---------aaggagtg-cca
                      D. sechellia  cggatacg----gat---------aaggagtg-cca
                         D. erecta  cggatacg----gat---------aaggagtg-cca
                         D. yakuba  cggatacg----gat---------aaggagtg-cca
                     D. ficusphila  aggatacg----gat---------aaggagtg-cca
                     D. eugracilis  aggatacg----gat---------aaggagtg-cca
                      D. biarmipes  gggacacg----gat---------aaggagtg-cca
                        D. suzukii  gggatacg----gat---------aaggagtg-cca
                     D. takahashii  cggatacg----gat---------aaggagtgccca
                        D. elegans  cggatacg----gat---------aaggagtg-cca
                       D. rhopaloa  aggatacg----gat---------aaggagtg-cca
                         D_serrata  aggacacacagcgaa---------gaggagtg-cca
                       D. kikkawai  aggacacacagcgaa---------gaggagtg-cca
                      D. ananassae  gggacacc----gataaggcgagcaaggagtg-cca
                    D. bipectinata  gggacacc----gacaaggcga--aaggagtg-cca
                       D_americana  -----ttg----gct----------------g-ctg
                    D_novamexicana  -----ttg----gct----------------g-ctg
                        D. virilis  -----ttg----gct----------------g-ctg
                        D_arizonae  tcgcttct----gct----------------g-ctg
                     D. mojavensis  tcgcttct----gct----------------g-ctg
                           D_hydei  ----ttct----gct----------------g-ctg
                       D_athabasca  tggttgct----gct---------aggcg-cg-ccg
                 D_pseudoobscura_1  tggttgct----gct---------aggcg-ca-ccg
                        D. miranda  tggttgct----gct---------aggcg-ca-ccg
                     D. persimilis  tggttgct----gct---------aggcg-ca-ccg
                  D. pseudoobscura  tggttgct----gct---------aggcg-ca-ccg
                      D_subobscura  tggctgct----gct---------aggcg-ca-ccg
                         D_obscura  tggctgct----gct---------aggca-ca-cca
                          D_nasuta  tggctgct----gct---------aggagttg-cct
                     D. albomicans  tggctgct----gct---------aggagttg-cct
                     D. willistoni  ====================================
                      D. grimshawi  ====================================
                      A_arabiensis  ====================================
         Proctacanthus_coquilletti  ====================================
                 Bactrocera_tryoni  ====================================
                Belgica_antarctica  ====================================
             Culicoides_sonorensis  ====================================
                      A. mellifera  ====================================
             Lutzomyia_longipalpis  ====================================
                Chironomus_tentans  ====================================
                         A_farauti  ====================================
               Stomoxys_calcitrans  ====================================
                  Bactrocera_oleae  ====================================
                Ceratitis_capitata  ====================================
                   Lucilia_cuprina  ====================================
              Bactrocera_latifrons  ====================================
               Bactrocera_dorsalis  ====================================
             Zeugodacus_cucurbitae  ====================================
                      M. domestica  ====================================
                Teleopsis_dalmanni  ====================================
                Zaprionus_indianus  ====================================
     Scaptodrosophila_lebanonensis  ====================================
                      T. castaneum  ====================================
                  Ephydra_gracilis  ====================================
                Paykullia_maculata  ====================================
                         D_montana  ====================================

Inserts between block 3 and 4 in window
                      D_americana 13bp
                   D_novamexicana 13bp
                       D. virilis 13bp
                       D_arizonae 15bp
                    D. mojavensis 15bp
                          D_hydei 15bp
                      D_athabasca 17bp
                D_pseudoobscura_1 19bp
                       D. miranda 19bp
B D                 D. persimilis 19bp
                 D. pseudoobscura 19bp
                     D_subobscura 17bp
                        D_obscura 22bp
                         D_nasuta 36bp
                    D. albomicans 36bp

Alignment block 4 of 1353 in window, 826452 - 826452, 1 bps 
B D                D. melanogaster  g
  D                    D. simulans  g
B D                   D. sechellia  g
                         D. erecta  g
                         D. yakuba  g
                     D. ficusphila  g
                     D. eugracilis  g
                      D. biarmipes  g
                        D. suzukii  g
                     D. takahashii  g
                        D. elegans  g
                       D. rhopaloa  g
                         D_serrata  g
                       D. kikkawai  g
                      D. ananassae  g
                    D. bipectinata  g
                    D. willistoni  =
                     D. grimshawi  =
                       D. miranda  =
                      D_athabasca  =
                 D. pseudoobscura  =
                       D_arizonae  =
                    D. mojavensis  =
                       D. virilis  =
                   D_novamexicana  =
                    D. albomicans  =
                         D_nasuta  =
                     A_arabiensis  =
        Proctacanthus_coquilletti  =
                Bactrocera_tryoni  =
               Belgica_antarctica  =
            Culicoides_sonorensis  =
                     A. mellifera  =
            Lutzomyia_longipalpis  =
               Chironomus_tentans  =
                        A_farauti  =
              Stomoxys_calcitrans  =
                 Bactrocera_oleae  =
               Ceratitis_capitata  =
                  Lucilia_cuprina  =
             Bactrocera_latifrons  =
              Bactrocera_dorsalis  =
            Zeugodacus_cucurbitae  =
                      D_americana  =
                     M. domestica  =
                D_pseudoobscura_1  =
                        D_obscura  =
                     D_subobscura  =
                          D_hydei  =
B D                  D. persimilis  =
               Teleopsis_dalmanni  =
               Zaprionus_indianus  =
    Scaptodrosophila_lebanonensis  =
                     T. castaneum  =
                 Ephydra_gracilis  =
               Paykullia_maculata  =
                        D_montana  =

Alignment block 5 of 1353 in window, 826453 - 826453, 1 bps 
B D                D. melanogaster  g
  D                    D. simulans  g
B D                   D. sechellia  g
                         D. erecta  g
                         D. yakuba  g
                     D. ficusphila  g
                     D. eugracilis  g
                      D. biarmipes  g
                        D. suzukii  g
                     D. takahashii  g
                        D. elegans  g
                       D. rhopaloa  g
                         D_serrata  c
                       D. kikkawai  c
                Paykullia_maculata  g
                    D. willistoni  =
                     D. grimshawi  =
                     D. ananassae  -
                       D. miranda  =
                      D_athabasca  =
                 D. pseudoobscura  =
                       D_arizonae  =
                    D. mojavensis  =
                       D. virilis  =
                   D_novamexicana  =
                    D. albomicans  =
                         D_nasuta  =
                     A_arabiensis  =
        Proctacanthus_coquilletti  =
                Bactrocera_tryoni  =
               Belgica_antarctica  =
            Culicoides_sonorensis  =
                     A. mellifera  =
            Lutzomyia_longipalpis  =
               Chironomus_tentans  =
                        A_farauti  =
              Stomoxys_calcitrans  =
                 Bactrocera_oleae  =
               Ceratitis_capitata  =
                  Lucilia_cuprina  =
             Bactrocera_latifrons  =
              Bactrocera_dorsalis  =
            Zeugodacus_cucurbitae  =
                      D_americana  =
                     M. domestica  =
                   D. bipectinata  -
                D_pseudoobscura_1  =
                        D_obscura  =
                     D_subobscura  =
                          D_hydei  =
B D                  D. persimilis  =
               Teleopsis_dalmanni  =
               Zaprionus_indianus  =
    Scaptodrosophila_lebanonensis  =
                     T. castaneum  =
                 Ephydra_gracilis  =
                        D_montana  =

Alignment block 6 of 1353 in window, 826454 - 826457, 4 bps 
B D                D. melanogaster  ataa
  D                    D. simulans  ataa
B D                   D. sechellia  ataa
                         D. erecta  ataa
                         D. yakuba  ataa
                     D. ficusphila  cgga
                     D. eugracilis  c---
                      D. biarmipes  ataa
                        D. suzukii  ataa
                     D. takahashii  ataa
                        D. elegans  cg--
                       D. rhopaloa  cg--
                         D_serrata  agga
                       D. kikkawai  agga
                       D_americana  -tcg
                    D_novamexicana  -tcg
                        D. virilis  -tcg
                        D_arizonae  -ccg
                     D. mojavensis  -ccg
                           D_hydei  -ccg
                       D_athabasca  -gaa
                 D_pseudoobscura_1  -gaa
                        D. miranda  -gaa
B D                  D. persimilis  -gaa
                  D. pseudoobscura  -gaa
                      D_subobscura  -gaa
                         D_obscura  -gaa
                   Lucilia_cuprina  acaa
                Paykullia_maculata  ataa
                    D. willistoni  ====
                     D. grimshawi  ====
                     D. ananassae  ----
                    D. albomicans  ====
                         D_nasuta  ====
                     A_arabiensis  ====
        Proctacanthus_coquilletti  ====
                Bactrocera_tryoni  ====
               Belgica_antarctica  ====
            Culicoides_sonorensis  ====
                     A. mellifera  ====
            Lutzomyia_longipalpis  ====
               Chironomus_tentans  ====
                        A_farauti  ====
              Stomoxys_calcitrans  ====
                 Bactrocera_oleae  ====
               Ceratitis_capitata  ====
             Bactrocera_latifrons  ====
              Bactrocera_dorsalis  ====
            Zeugodacus_cucurbitae  ====
                     M. domestica  ====
                   D. bipectinata  ----
               Teleopsis_dalmanni  ====
               Zaprionus_indianus  ====
    Scaptodrosophila_lebanonensis  ====
                     T. castaneum  ====
                 Ephydra_gracilis  ====
                        D_montana  ====

Inserts between block 6 and 7 in window
                      D_americana 28bp
                   D_novamexicana 1bp
                       D. virilis 3bp
                       D_arizonae 13bp
                    D. mojavensis 13bp
                          D_hydei 13bp
                      D_athabasca 10bp
                D_pseudoobscura_1 15bp
                       D. miranda 15bp
B D                 D. persimilis 15bp
                 D. pseudoobscura 15bp
                     D_subobscura 10bp
                        D_obscura 10bp

Alignment block 7 of 1353 in window, 826458 - 826481, 24 bps 
B D                D. melanogaster  g---g---agatcc-agga---------ggaat--------ataggag--
  D                    D. simulans  g---g---agatcc-agga---------ggaat--------ataggag--
B D                   D. sechellia  g---a---agatcc-agga---------ggaat--------ataggag--
                         D. erecta  g---g---agatcc-agga---------ggaat--------ataggag--
                         D. yakuba  g---g---agatcc-agga---------ggaat--------ataggag--
                     D. ficusphila  g---atttagattc-ggga---------ggaac--------a-aggag--
                     D. eugracilis  g---g---agatcc-agga---------ggaat--------ataggag--
                      D. biarmipes  ----g---agctcc-agga---------ggaac--------ataggag--
                        D. suzukii  ----g---agatcc-agga---------ggaat--------ataggag--
                     D. takahashii  ggagg---agatcc-agca---------ggaat--------ataggag--
                        D. elegans  ----g---agaatc-agga---------ggaat--------ataggag--
                       D. rhopaloa  ----g---agaatc-agga---------ggaat--------agaggag--
                         D_serrata  g---g---agcagt-agca---------gggat----------aggag--
                       D. kikkawai  g---g---agcagg-agca---------gggat----------aggag--
                      D. ananassae  ----g---agactc-ggca---------ggaat----------aggag--
                    D. bipectinata  ----g---agactcgggca---------ggaat----------aggag--
                    D_novamexicana  -------------------------------------------cgtcg--
                        D. virilis  --------------------tcgccgtcgtcgt----------cgtcg--
                        D_arizonae  ----------------ggagttgccgtcgtcat----------cgcag--
                     D. mojavensis  ----------------ggagttgccgtcgtcat----------cgcag--
                           D_hydei  ----------------ggagttgccgtcgtc----------------g--
                       D_athabasca  ----------------------------ggaat----------aggag--
                 D_pseudoobscura_1  ----------------------------ggaat----------aggag--
                        D. miranda  ----------------------------ggaat----------aggag--
B D                  D. persimilis  ----------------------------ggaat----------aggag--
                  D. pseudoobscura  ----------------------------ggaat----------aggag--
                      D_subobscura  ----------------------------ggaat----------aggag--
                         D_obscura  ----------------------------ggaat----------aggag--
                   Lucilia_cuprina  --------------------------cgacaacgacgaagaaaaaaaaaa
                Paykullia_maculata  --------------------------cgacgac--------caagaaaaa
                    D. willistoni  ==================================================
                     D. grimshawi  ==================================================
                    D. albomicans  ==================================================
                         D_nasuta  ==================================================
                     A_arabiensis  ==================================================
        Proctacanthus_coquilletti  ==================================================
                Bactrocera_tryoni  ==================================================
               Belgica_antarctica  ==================================================
            Culicoides_sonorensis  ==================================================
                     A. mellifera  ==================================================
            Lutzomyia_longipalpis  ==================================================
               Chironomus_tentans  ==================================================
                        A_farauti  ==================================================
              Stomoxys_calcitrans  ==================================================
                 Bactrocera_oleae  ==================================================
               Ceratitis_capitata  ==================================================
             Bactrocera_latifrons  ==================================================
              Bactrocera_dorsalis  ==================================================
            Zeugodacus_cucurbitae  ==================================================
                      D_americana  ==================================================
                     M. domestica  ==================================================
               Teleopsis_dalmanni  ==================================================
               Zaprionus_indianus  ==================================================
    Scaptodrosophila_lebanonensis  ==================================================
                     T. castaneum  ==================================================
                 Ephydra_gracilis  ==================================================
                        D_montana  ==================================================

Inserts between block 7 and 8 in window
                  Lucilia_cuprina 5bp
               Paykullia_maculata 5bp

Alignment block 8 of 1353 in window, 826482 - 826489, 8 bps 
B D                D. melanogaster  t----tgccagt
  D                    D. simulans  t----tgccagt
B D                   D. sechellia  t----tgccagt
                         D. erecta  t----tgccagt
                         D. yakuba  t----tgccagt
                     D. ficusphila  t----tg-----
                     D. eugracilis  t----tgccaat
                      D. biarmipes  t----tgccagt
                        D. suzukii  t----tgccagt
                     D. takahashii  t----tgccagt
                        D. elegans  t----tgt----
                       D. rhopaloa  t----tgt----
                         D_serrata  t----tgccgtc
                       D. kikkawai  t----tgccgtc
                      D. ananassae  t----tgccacc
                    D. bipectinata  t----tgccacc
                    D_novamexicana  t----cgtcgcc
                        D. virilis  t----cgtcgcc
                        D_arizonae  t----cgccgtc
                     D. mojavensis  t----cgccgtc
                           D_hydei  t----cgccgtc
                       D_athabasca  ttgcctgccgtt
                 D_pseudoobscura_1  t----tgccgtt
                        D. miranda  t----tgccgtt
B D                  D. persimilis  t----tgccgtt
                  D. pseudoobscura  t----tgccgtt
                      D_subobscura  t----tgccgtt
                         D_obscura  t----tgccgtt
             Zeugodacus_cucurbitae  t----tgccata
                   Lucilia_cuprina  t----tttcatc
                Paykullia_maculata  t----tttcatc
                    D. willistoni  ============
                     D. grimshawi  ============
                    D. albomicans  ============
                         D_nasuta  ============
                     A_arabiensis  ============
        Proctacanthus_coquilletti  ============
                Bactrocera_tryoni  ============
               Belgica_antarctica  ============
            Culicoides_sonorensis  ============
                     A. mellifera  ============
            Lutzomyia_longipalpis  ============
               Chironomus_tentans  ============
                        A_farauti  ============
              Stomoxys_calcitrans  ============
                 Bactrocera_oleae  ============
               Ceratitis_capitata  ============
             Bactrocera_latifrons  ============
              Bactrocera_dorsalis  ============
                      D_americana  ============
                     M. domestica  ============
               Teleopsis_dalmanni  ============
               Zaprionus_indianus  ============
    Scaptodrosophila_lebanonensis  ============
                     T. castaneum  ============
                 Ephydra_gracilis  ============
                        D_montana  ============

Inserts between block 8 and 9 in window
                   D_novamexicana 2bp
                       D. virilis 2bp
                      D_athabasca 13bp
                D_pseudoobscura_1 13bp
                       D. miranda 13bp
B D                 D. persimilis 13bp
                 D. pseudoobscura 13bp
                     D_subobscura 15bp
                        D_obscura 15bp

Alignment block 9 of 1353 in window, 826490 - 826496, 7 bps 
B D                D. melanogaster  ccaac---cg
  D                    D. simulans  ccaac---cg
B D                   D. sechellia  ccaac---cg
                         D. erecta  ccaac---cg
                         D. yakuba  ccaac---cg
                     D. ficusphila  ccaat---cg
                     D. eugracilis  ccaat---cg
                      D. biarmipes  cccat---cg
                        D. suzukii  cccat---cg
                     D. takahashii  ccaat---cg
                        D. elegans  ccaat---cg
                       D. rhopaloa  -caat---cg
                         D_serrata  gcaag---cg
                       D. kikkawai  gcaag---cg
                      D. ananassae  gcagt---cg
                    D. bipectinata  gcagt---cg
                       D_americana  --aaa---ct
                    D_novamexicana  --aaa---ct
                        D. virilis  --aaa---ct
                        D_arizonae  gcngt---cg
                     D. mojavensis  gcagt---cg
                           D_hydei  gccgt---cg
                       D_athabasca  gcagc---cg
                 D_pseudoobscura_1  gcagc---cg
                        D. miranda  gcagc---cg
B D                  D. persimilis  gcagc---cg
                  D. pseudoobscura  gcagc---cg
                      D_subobscura  gcagc---cg
                         D_obscura  gcagc---cg
                          D_nasuta  ----c---ca
                     D. albomicans  ----c---ca
             Zeugodacus_cucurbitae  aaaaccga--
                   Lucilia_cuprina  gtagt-----
                Paykullia_maculata  gtagt-----
                    D. willistoni  ==========
                     D. grimshawi  ==========
                     A_arabiensis  ==========
        Proctacanthus_coquilletti  ==========
                Bactrocera_tryoni  ==========
               Belgica_antarctica  ==========
            Culicoides_sonorensis  ==========
                     A. mellifera  ==========
            Lutzomyia_longipalpis  ==========
               Chironomus_tentans  ==========
                        A_farauti  ==========
              Stomoxys_calcitrans  ==========
                 Bactrocera_oleae  ==========
               Ceratitis_capitata  ==========
             Bactrocera_latifrons  ==========
              Bactrocera_dorsalis  ==========
                     M. domestica  ==========
               Teleopsis_dalmanni  ==========
               Zaprionus_indianus  ==========
    Scaptodrosophila_lebanonensis  ==========
                     T. castaneum  ==========
                 Ephydra_gracilis  ==========
                        D_montana  ==========

Inserts between block 9 and 10 in window
                      D_athabasca 292bp
                D_pseudoobscura_1 32bp
                       D. miranda 32bp
B D                 D. persimilis 32bp
                 D. pseudoobscura 32bp
                     D_subobscura 32bp
                        D_obscura 32bp
                         D_nasuta 4bp
                    D. albomicans 4bp
            Zeugodacus_cucurbitae 3bp

Alignment block 10 of 1353 in window, 826497 - 826497, 1 bps 
B D                D. melanogaster  c
  D                    D. simulans  c
B D                   D. sechellia  c
                         D. erecta  c
                         D. yakuba  c
                     D. ficusphila  c
                     D. eugracilis  c
                      D. biarmipes  c
                        D. suzukii  c
                     D. takahashii  c
                        D. elegans  c
                       D. rhopaloa  c
                         D_serrata  c
                       D. kikkawai  c
                      D. ananassae  c
                    D. bipectinata  c
                       D_americana  t
                    D_novamexicana  t
                        D. virilis  t
                        D_arizonae  c
                     D. mojavensis  c
                           D_hydei  c
                       D_athabasca  c
                 D_pseudoobscura_1  c
                        D. miranda  c
B D                  D. persimilis  c
                  D. pseudoobscura  c
                      D_subobscura  c
                         D_obscura  c
                          D_nasuta  t
                     D. albomicans  t
                    D. willistoni  =
                     D. grimshawi  =
                     A_arabiensis  =
        Proctacanthus_coquilletti  =
                Bactrocera_tryoni  =
               Belgica_antarctica  =
            Culicoides_sonorensis  =
                     A. mellifera  =
            Lutzomyia_longipalpis  =
               Chironomus_tentans  =
                        A_farauti  =
              Stomoxys_calcitrans  =
                 Bactrocera_oleae  =
               Ceratitis_capitata  =
                  Lucilia_cuprina  -
             Bactrocera_latifrons  =
              Bactrocera_dorsalis  =
            Zeugodacus_cucurbitae  =
                     M. domestica  =
               Teleopsis_dalmanni  =
               Zaprionus_indianus  =
    Scaptodrosophila_lebanonensis  =
                     T. castaneum  =
                 Ephydra_gracilis  =
               Paykullia_maculata  -
                        D_montana  =

Inserts between block 10 and 11 in window
                     D. ananassae 7bp
                   D. bipectinata 7bp
                      D_americana 2bp
                   D_novamexicana 2bp
                       D. virilis 2bp
                       D_arizonae 11bp
                    D. mojavensis 11bp
                          D_hydei 11bp

Alignment block 11 of 1353 in window, 826498 - 826498, 1 bps 
B D                D. melanogaster  t
  D                    D. simulans  t
B D                   D. sechellia  t
                         D. erecta  t
                         D. yakuba  t
                     D. ficusphila  t
                     D. eugracilis  t
                      D. biarmipes  t
                        D. suzukii  t
                     D. takahashii  t
                        D. elegans  t
                       D. rhopaloa  t
                         D_serrata  t
                       D. kikkawai  t
                      D. ananassae  g
                    D. bipectinata  g
                       D_americana  g
                    D_novamexicana  g
                        D. virilis  g
                        D_arizonae  g
                     D. mojavensis  g
                           D_hydei  g
                      D. grimshawi  t
                       D_athabasca  g
                 D_pseudoobscura_1  g
                        D. miranda  g
B D                  D. persimilis  g
                  D. pseudoobscura  g
                      D_subobscura  g
                         D_obscura  g
                Zaprionus_indianus  t
                          D_nasuta  t
                     D. albomicans  t
                  Ephydra_gracilis  t
                   Lucilia_cuprina  t
                Paykullia_maculata  t
                    D. willistoni  =
                     A_arabiensis  =
        Proctacanthus_coquilletti  =
                Bactrocera_tryoni  =
               Belgica_antarctica  =
            Culicoides_sonorensis  =
                     A. mellifera  =
            Lutzomyia_longipalpis  =
               Chironomus_tentans  =
                        A_farauti  =
              Stomoxys_calcitrans  =
                 Bactrocera_oleae  =
               Ceratitis_capitata  =
             Bactrocera_latifrons  =
              Bactrocera_dorsalis  =
            Zeugodacus_cucurbitae  =
                     M. domestica  =
               Teleopsis_dalmanni  =
    Scaptodrosophila_lebanonensis  =
                     T. castaneum  =
                        D_montana  =

Alignment block 12 of 1353 in window, 826499 - 826552, 54 bps 
B D                D. melanogaster  tcgtctccggtaggtacacac--aaaat--attcggctgctccttt-t--------------------ta
  D                    D. simulans  tcgtctccggtaggtacacac--aaaat--attcggctgctccttt-t--------------------ta
B D                   D. sechellia  tcgtctccggtaggtacacac--aaaat--attcggctgctccttt-t--------------------ta
                         D. erecta  tcgtctccggtaggtacacac--aaaat--attcggctgctccttt-t--------------------ta
                         D. yakuba  tcgtctccggtaggtacacac--aaaat--attcggctgctcc-tt-t--------------------ta
                     D. ficusphila  tcgtctccggtaggtacacac--aaaa---attcggctgctccttt-t--------------------ta
                     D. eugracilis  tcgtctccggtaggtacacac--aaaat--gttcggctgctccttt-t--------------------ta
                      D. biarmipes  tcgtctccggtaggtacacac--aaaat--attcggctgctcc-tt-t--------------------ta
                        D. suzukii  tcgtctccggtaggtacacac--aaaat--attcggctgctcc-tt-t--------------------ta
                     D. takahashii  tcgtctccggtaggtacacac--aaaat--attcggctgctccttt-t--------------------ta
                        D. elegans  tcgtctccggtaggtacacac--aaaat--attcggctgctccttt-t--------------------ta
                       D. rhopaloa  tcgtctccggtaggtacacac--aaaat--attcggctgctccttt-t----------------------
                         D_serrata  tcgtctccggtaggtacacac--aaaat--attcggctgctccttt-t--------------------ta
                       D. kikkawai  tcgtctccggtaggtacacac--aaaat--attcggctgctccttt-t--------------------ta
                      D. ananassae  tcgtctccggtaggtacacac--aaaat--attcggctgctcc-tt-t--------------------ca
                    D. bipectinata  tcgtctccggtaggtacacac--aaaat--attcggctgctcc-tt-t--------------------ca
                       D_americana  tcgtctccggtaggtacacac--aaaat--atacggctgctcctgt-t--------------------ta
                    D_novamexicana  tcgtctccggtaggtacacac--aaaat--atacggctgctcctgt-t--------------------ta
                        D. virilis  tcgtctccggtaggtacacac--aaaat--atacggctgctcctgt-t--------------------ta
                        D_arizonae  tcgtctccggtaggtacacac--aaaat--atacggttgctcctgt-t--------------------ta
                     D. mojavensis  tcgtctccggtaggtacacac--aaaat--atactgctgctcctgt-t--------------------ta
                           D_hydei  tcgtctccggtaggtacacac--aaaat--atacggctgctcctgt-t--------------------ta
                      D. grimshawi  tcgtctccggtaggtacacac--aaaat--atacggctgctcctgt-t--------------------ta
                       D_athabasca  tcgtctccggtaggtacacac--aaaat--attcggctgctcct-t-t--------------------ta
                 D_pseudoobscura_1  tcgtctccggtaggtacacac--aaaat--attcggctgctcct-t-t--------------------ta
                        D. miranda  tcgtctccggtaggtacacac--aaaat--attcggctgctcct-t-t--------------------ta
B D                  D. persimilis  tcgtctccggtaggtacacac--aaaat--attcggctgctcct-t-t--------------------ta
                  D. pseudoobscura  tcgtctccggtaggtacacac--aaaat--attcggctgctcct-t-t--------------------ta
                      D_subobscura  tcgtctccggtaggtacacac--aaaat--attcggctgctcct-t-t--------------------ta
                         D_obscura  tcgtctccggtaggtacacac--aaaat--attcggctgctcct-t-t--------------------ta
                Zaprionus_indianus  tcgtctccggtaggtacacac--aaaat--atacggctgctcctgt-t--------------------ta
                          D_nasuta  tcgtctccggtaggtacacac--aaaat--atacggctgctcctgt-t--------------------ta
                     D. albomicans  tcgtctccggtaggtacacac--aaaat--atacggctgctcctgt-t--------------------ta
               Bactrocera_dorsalis  tcgtctccggtaggtacacaca-aaaattcattctact-------t-t--------------------tt
              Bactrocera_latifrons  tcgtctccggtaggtacacaca-aaaattcattctact-------t-t--------------------tt
                 Bactrocera_tryoni  tcgtctccggtaggtacacaca-aaaattcattctact-------t-t--------------------tt
                  Bactrocera_oleae  ttgtctccggtaggtacacaca-aaaattcattctact-------t-t--------------------tt
             Zeugodacus_cucurbitae  tcgtctccggtaggtacacaca-aaaattcattctact-------t-t--------------------tt
                Ceratitis_capitata  tcgtctccggtaggtacacaca-aaaattcattctact-------tat--------------------tt
                  Ephydra_gracilis  ttgtctccggtaggtacacacacaaaatacatttcttt-------t-ttcatgtttgttttatttgtgtt
                   Lucilia_cuprina  ttgtctccggtaggtacacacacaaaat--atccgacc-------a-c--------------------at
                Paykullia_maculata  ttgtctccggtaggtacacacacaaaat--atccgacc-------a-c--------------------at
                    D. willistoni  ======================================================================
                     A_arabiensis  ======================================================================
        Proctacanthus_coquilletti  ======================================================================
               Belgica_antarctica  ======================================================================
            Culicoides_sonorensis  ======================================================================
                     A. mellifera  ======================================================================
            Lutzomyia_longipalpis  ======================================================================
               Chironomus_tentans  ======================================================================
                        A_farauti  ======================================================================
              Stomoxys_calcitrans  ======================================================================
                     M. domestica  ======================================================================
               Teleopsis_dalmanni  ======================================================================
    Scaptodrosophila_lebanonensis  ======================================================================
                     T. castaneum  ======================================================================
                        D_montana  ======================================================================

                   D. melanogaster  -----gctcctg-tt
                       D. simulans  -----gctcctg-tt
                      D. sechellia  -----gctcctg-tt
                         D. erecta  -----gctcctg-tt
                         D. yakuba  -----gctcctg-tt
                     D. ficusphila  -----gctcttg-tt
                     D. eugracilis  -----gctcctg-tt
                      D. biarmipes  -----gctcctg-tt
                        D. suzukii  -----gctcctg-tt
                     D. takahashii  -----gctcctg-tt
                        D. elegans  -----gctcctg-tt
                       D. rhopaloa  -----actcctg-tt
                         D_serrata  -----gctcctg-tt
                       D. kikkawai  -----gctcctg-tt
                      D. ananassae  -----gctcctg-tt
                    D. bipectinata  -----gctcctt-tt
                       D_americana  -----gctcctg-tt
                    D_novamexicana  -----gctcctg-tt
                        D. virilis  -----gctcctg-tt
                        D_arizonae  -----gctcctg-tt
                     D. mojavensis  -----gctcctg-tt
                           D_hydei  -----gctcctg-tt
                      D. grimshawi  -----gctcctg-tt
                       D_athabasca  -----gctcctg-tt
                 D_pseudoobscura_1  -----gctcctg-tt
                        D. miranda  -----gctcctg-tt
                     D. persimilis  -----gctcctg-tt
                  D. pseudoobscura  -----gctcctg-tt
                      D_subobscura  -----gctcctg-tt
                         D_obscura  gctccgctcctg-tt
                Zaprionus_indianus  -----gctcctg-tt
                          D_nasuta  -----gctcctg-tt
                     D. albomicans  -----gctcctg-tt
               Bactrocera_dorsalis  -----gctcctc-tt
              Bactrocera_latifrons  -----gctcctc-tt
                 Bactrocera_tryoni  -----gctcctc-tt
                  Bactrocera_oleae  -----gctcctcttt
             Zeugodacus_cucurbitae  -----gctcctc-tt
                Ceratitis_capitata  -----gctcctc-tt
                  Ephydra_gracilis  -----gtttttt-tt
                   Lucilia_cuprina  -----atatcca-gt
                Paykullia_maculata  -----atatcca-gt
                     D. willistoni  ===============
                      A_arabiensis  ===============
         Proctacanthus_coquilletti  ===============
                Belgica_antarctica  ===============
             Culicoides_sonorensis  ===============
                      A. mellifera  ===============
             Lutzomyia_longipalpis  ===============
                Chironomus_tentans  ===============
                         A_farauti  ===============
               Stomoxys_calcitrans  ===============
                      M. domestica  ===============
                Teleopsis_dalmanni  ===============
     Scaptodrosophila_lebanonensis  ===============
                      T. castaneum  ===============
                         D_montana  ===============

Inserts between block 12 and 13 in window
                    D. ficusphila 4bp
                    D. eugracilis 2bp
                     D. biarmipes 2bp
                       D. suzukii 2bp
                    D. takahashii 2bp
                       D. elegans 2bp
                      D. rhopaloa 2bp
                        D_serrata 2bp
                      D. kikkawai 2bp
                     D. ananassae 2bp
                   D. bipectinata 2bp
                      D_americana 3bp
                   D_novamexicana 3bp
                       D. virilis 3bp
                       D_arizonae 3bp
                    D. mojavensis 3bp
                          D_hydei 3bp
                     D. grimshawi 3bp
                      D_athabasca 3bp
                D_pseudoobscura_1 3bp
                       D. miranda 3bp
B D                 D. persimilis 3bp
                 D. pseudoobscura 3bp
                     D_subobscura 3bp
                        D_obscura 3bp
               Zaprionus_indianus 3bp
                         D_nasuta 3bp
                    D. albomicans 3bp
            Zeugodacus_cucurbitae 22821bp
               Ceratitis_capitata 3bp
                 Ephydra_gracilis 11bp
                  Lucilia_cuprina 7bp
               Paykullia_maculata 4bp

Alignment block 13 of 1353 in window, 826553 - 826560, 8 bps 
B D                D. melanogaster  --cgaatc-t--------------------c
  D                    D. simulans  --cgaatc-t--------------------c
B D                   D. sechellia  --cgaatc-t--------------------c
                         D. erecta  --cgaatc-t--------------------c
                         D. yakuba  --cgaatc-t--------------------c
                     D. ficusphila  --cgactc-t--------------------c
                     D. eugracilis  --tggtac-t--------------------c
                      D. biarmipes  --tgccac-t--------------------c
                        D. suzukii  --tgccac-t--------------------c
                     D. takahashii  --tgccac-t--------------------c
                        D. elegans  --tggc-c-t--------------------c
                       D. rhopaloa  --tagc-c-t--------------------t
                         D_serrata  --tgccgc-t--------------------c
                       D. kikkawai  --tgtcgc-t--------------------c
                      D. ananassae  ---gcctc-t--------------------c
                    D. bipectinata  ---gcctc-t--------------------c
                       D_americana  --tgtctc-g--------------------c
                    D_novamexicana  --tgtctc-g--------------------c
                        D. virilis  --tgtctc-g--------------------c
                        D_arizonae  --tgtctc-g--------------------c
                     D. mojavensis  --tgtctc-g--------------------c
                           D_hydei  --tgtctc-g--------------------c
                      D. grimshawi  --tgtctc-g--------------------c
                       D_athabasca  --tgtctctgctctctctctgtctctctctc
                 D_pseudoobscura_1  --tgtctctg------------ctctctctc
                        D. miranda  --tgtctctg--------------ctctctc
B D                  D. persimilis  --tgtctctgctc--------tctctctctc
                  D. pseudoobscura  --tgtctctg------------ctctctctc
                      D_subobscura  --tgtctctg------------------ctc
                         D_obscura  --tgtctctg------------------ctc
                Zaprionus_indianus  --tgtctc-g------------ctctctctc
                          D_nasuta  --tctctc-t------------ctcgctcgc
                     D. albomicans  --tctctc-t------------ctcgctcgc
               Bactrocera_dorsalis  -tcatact-----------------------
              Bactrocera_latifrons  -tcatact-----------------------
                 Bactrocera_tryoni  -tcatact-----------------------
                  Bactrocera_oleae  -ttatact-----------------------
                Ceratitis_capitata  --cataca-----------------------
                  Ephydra_gracilis  -tggttct-----------------------
                   Lucilia_cuprina  tttatccc-----------------------
                Paykullia_maculata  tttatccc-----------------------
                    D. willistoni  ===============================
                     A_arabiensis  ===============================
        Proctacanthus_coquilletti  ===============================
               Belgica_antarctica  ===============================
            Culicoides_sonorensis  ===============================
                     A. mellifera  ===============================
            Lutzomyia_longipalpis  ===============================
               Chironomus_tentans  ===============================
                        A_farauti  ===============================
              Stomoxys_calcitrans  ===============================
            Zeugodacus_cucurbitae  ===============================
                     M. domestica  ===============================
               Teleopsis_dalmanni  ===============================
    Scaptodrosophila_lebanonensis  ===============================
                     T. castaneum  ===============================
                        D_montana  ===============================

Inserts between block 13 and 14 in window
              Bactrocera_dorsalis 1bp
             Bactrocera_latifrons 1bp
                Bactrocera_tryoni 1bp
                 Bactrocera_oleae 2bp
               Ceratitis_capitata 1bp
                 Ephydra_gracilis 1bp
                  Lucilia_cuprina 32588bp

Alignment block 14 of 1353 in window, 826561 - 826561, 1 bps 
B D                D. melanogaster  t
  D                    D. simulans  t
B D                   D. sechellia  t
                         D. erecta  t
                         D. yakuba  t
                     D. ficusphila  t
                     D. eugracilis  t
                      D. biarmipes  t
                        D. suzukii  t
                     D. takahashii  t
                        D. elegans  t
                       D. rhopaloa  t
                         D_serrata  t
                       D. kikkawai  t
                      D. ananassae  t
                    D. bipectinata  t
                       D_americana  t
                    D_novamexicana  t
                        D. virilis  t
                        D_arizonae  t
                     D. mojavensis  t
                           D_hydei  t
                      D. grimshawi  t
                       D_athabasca  t
                 D_pseudoobscura_1  t
                        D. miranda  t
B D                  D. persimilis  t
                  D. pseudoobscura  t
                      D_subobscura  t
                         D_obscura  t
                Zaprionus_indianus  t
                          D_nasuta  t
                     D. albomicans  t
               Bactrocera_dorsalis  t
              Bactrocera_latifrons  t
                 Bactrocera_tryoni  t
                Ceratitis_capitata  c
                  Ephydra_gracilis  t
                    D. willistoni  =
                     A_arabiensis  =
        Proctacanthus_coquilletti  =
               Belgica_antarctica  =
            Culicoides_sonorensis  =
                     A. mellifera  =
            Lutzomyia_longipalpis  =
               Chironomus_tentans  =
                        A_farauti  =
              Stomoxys_calcitrans  =
                 Bactrocera_oleae  =
                  Lucilia_cuprina  =
            Zeugodacus_cucurbitae  =
                     M. domestica  =
               Teleopsis_dalmanni  =
    Scaptodrosophila_lebanonensis  =
                     T. castaneum  =
                        D_montana  =

Inserts between block 14 and 15 in window
               Zaprionus_indianus 8bp
              Bactrocera_dorsalis 19823bp
             Bactrocera_latifrons 22729bp
                Bactrocera_tryoni 23496bp
               Ceratitis_capitata 1bp
                 Ephydra_gracilis 4bp

Alignment block 15 of 1353 in window, 826562 - 826563, 2 bps 
B D                D. melanogaster  ca
  D                    D. simulans  ct
B D                   D. sechellia  ct
                         D. erecta  ct
                         D. yakuba  ct
                     D. ficusphila  ct
                     D. eugracilis  ct
                      D. biarmipes  c-
                        D. suzukii  c-
                     D. takahashii  ct
                        D. elegans  ct
                       D. rhopaloa  ct
                         D_serrata  ct
                       D. kikkawai  ct
                      D. ananassae  ct
                    D. bipectinata  ct
                       D_americana  ca
                    D_novamexicana  ca
                        D. virilis  ca
                        D_arizonae  ct
                     D. mojavensis  ct
                           D_hydei  ct
                      D. grimshawi  ct
                       D_athabasca  ct
                 D_pseudoobscura_1  ct
                        D. miranda  ct
B D                  D. persimilis  ct
                  D. pseudoobscura  ct
                      D_subobscura  ct
                         D_obscura  ct
                Zaprionus_indianus  ct
                          D_nasuta  ct
                     D. albomicans  ct
                    D. willistoni  ==
                     A_arabiensis  ==
        Proctacanthus_coquilletti  ==
                Bactrocera_tryoni  ==
               Belgica_antarctica  ==
            Culicoides_sonorensis  ==
                     A. mellifera  ==
            Lutzomyia_longipalpis  ==
               Chironomus_tentans  ==
                        A_farauti  ==
              Stomoxys_calcitrans  ==
                 Bactrocera_oleae  ==
               Ceratitis_capitata  ==
                  Lucilia_cuprina  ==
             Bactrocera_latifrons  ==
              Bactrocera_dorsalis  ==
            Zeugodacus_cucurbitae  ==
                     M. domestica  ==
               Teleopsis_dalmanni  ==
    Scaptodrosophila_lebanonensis  ==
                     T. castaneum  ==
                 Ephydra_gracilis  ==
                        D_montana  ==

Alignment block 16 of 1353 in window, 826564 - 826578, 15 bps 
B D                D. melanogaster  -------------cg--gctctctctctcg
  D                    D. simulans  -------------cg--gctct--------
B D                   D. sechellia  -------------cg--g--ct--------
                         D. erecta  -------------cg--gctct--------
                         D. yakuba  -------------cg--gctct--------
                     D. ficusphila  -------------cg--gttct--------
                     D. eugracilis  -------------ca--aatct------cg
                      D. biarmipes  -------------cg---gcct--------
                        D. suzukii  -------------cg--agtct--------
                     D. takahashii  -------------cg--gggct--------
                        D. elegans  -------------cgaaaatct--------
                       D. rhopaloa  -------------cg--aatct--------
                         D_serrata  -------------ct---ctgt--------
                       D. kikkawai  -------------ct---gtct--------
                      D. ananassae  -------------ct---ctct--------
                    D. bipectinata  -------------ct---ctgt--------
                       D_americana  -------------tg-----ct--------
                    D_novamexicana  -------------tg-----ct--------
                        D. virilis  -------------tg-----ct--------
                        D_arizonae  -------------ca-----ct--------
                     D. mojavensis  -------------ca-----ca--------
                           D_hydei  -------------ca-----ct--------
                      D. grimshawi  -------------ct-----ct--------
                       D_athabasca  -------------ta-----ct--------
                 D_pseudoobscura_1  -------------ca-----ct--------
                        D. miranda  -------------ca-----ct--------
B D                  D. persimilis  -------------ca-----ct--------
                  D. pseudoobscura  -------------ca-----ct--------
                      D_subobscura  -------------ca-----ct--------
                         D_obscura  -------------ca-----ct--------
                Zaprionus_indianus  -------------ca-----ct--------
                          D_nasuta  -------------ca-----tt--------
                     D. albomicans  -------------ca-----tt--------
                  Bactrocera_oleae  gtgcacattcgctcg---------------
                Ceratitis_capitata  -cacatatttattcg---------------
                  Ephydra_gracilis  tcggcgaaccgtttg---------------
                    D. willistoni  ==============================
                     A_arabiensis  ==============================
        Proctacanthus_coquilletti  ==============================
                Bactrocera_tryoni  ==============================
               Belgica_antarctica  ==============================
            Culicoides_sonorensis  ==============================
                     A. mellifera  ==============================
            Lutzomyia_longipalpis  ==============================
               Chironomus_tentans  ==============================
                        A_farauti  ==============================
              Stomoxys_calcitrans  ==============================
                  Lucilia_cuprina  ==============================
             Bactrocera_latifrons  ==============================
              Bactrocera_dorsalis  ==============================
            Zeugodacus_cucurbitae  ==============================
                     M. domestica  ==============================
               Teleopsis_dalmanni  ==============================
    Scaptodrosophila_lebanonensis  ==============================
                     T. castaneum  ==============================
                        D_montana  ==============================

Inserts between block 16 and 17 in window
                 Bactrocera_oleae 40586bp
               Ceratitis_capitata 12bp
                 Ephydra_gracilis 7bp

Alignment block 17 of 1353 in window, 826579 - 826618, 40 bps 
B D                D. melanogaster  gctct-----------------------------------------ctc---------------------
  D                    D. simulans  -ctct-----------------------------------------ctc---------------------
B D                   D. sechellia  -ctct-----------------------------------------ctc---------------------
                         D. erecta  ------------------------------------------------c---------------------
                         D. yakuba  ------------------------------------------------c---------------------
                     D. ficusphila  ----------------------------------------------------------------------
                     D. eugracilis  aatct-----------------------------------------ctc---------------------
                      D. biarmipes  -ctct----------cttcg--------------------------ctc---------------------
                        D. suzukii  -ctct----------ct------------------------------tc---------------------
                     D. takahashii  -ctct----------ctttgct-----gt-----------------ctc---------------------
                        D. elegans  -ctca----------ttcat--------------------------ctc---------------------
                       D. rhopaloa  -ctca----------tttat--------------------------ctc---------------------
                         D_serrata  -ctcc----------ctctctctatctgc-----------------ttt---------------------
                       D. kikkawai  -ctcc----------------------gc-----------------ttt---------------------
                      D. ananassae  -ctct----------ctgtgtgtgtctgt-----------------ctt---------------------
                    D. bipectinata  -ctct----------c----tctcttact-----------------ctt---------------------
                       D_americana  -tact-----------------------------------------tgt---------------------
                    D_novamexicana  -tact-----------------------------------------tgt---------------------
                        D. virilis  -tact-----------------------------------------cgt---------------------
                        D_arizonae  -cgtt-----------------------------------------cgc---------------------
                     D. mojavensis  -cgtt-----------------------------------------cgc---------------------
                           D_hydei  -tgtt-----------------------------------------cgc---------------------
                      D. grimshawi  -ctct-----------------------------------------ctc---------------------
                       D_athabasca  -tagt-----------------------------------------ggt-----g---------------
                 D_pseudoobscura_1  -tagtggtctctcgtctctatctctctgtctgtctttgcatc----gctctctct---------------
                        D. miranda  -tagtggtctctcgtctctatctctctgtctgtctttgcatcgctctctctctcgcgccctcactcgcct
B D                  D. persimilis  -tagt-----------------------------------------ggtctctcg---------------
                  D. pseudoobscura  -tagt-----------------------------------------ggtctctcg---------------
                      D_subobscura  -tagt-----------------------------------------ggt-----g---------------
                         D_obscura  -tagt-----------------------------------------ggt-----g---------------
                Zaprionus_indianus  -cact-----------------------------------------cac---------------------
                          D_nasuta  -cact----------ctctaactcgttaac----------------gac---------------------
                     D. albomicans  -cact----------ctctaactcgttaac----------------gac---------------------
                Ceratitis_capitata  ----------------------------------------------------------------------
                  Ephydra_gracilis  ----------------------------------------------------------------------
                    D. willistoni  ======================================================================
                     A_arabiensis  ======================================================================
        Proctacanthus_coquilletti  ======================================================================
                Bactrocera_tryoni  ======================================================================
               Belgica_antarctica  ======================================================================
            Culicoides_sonorensis  ======================================================================
                     A. mellifera  ======================================================================
            Lutzomyia_longipalpis  ======================================================================
               Chironomus_tentans  ======================================================================
                        A_farauti  ======================================================================
              Stomoxys_calcitrans  ======================================================================
                 Bactrocera_oleae  ======================================================================
                  Lucilia_cuprina  ======================================================================
             Bactrocera_latifrons  ======================================================================
              Bactrocera_dorsalis  ======================================================================
            Zeugodacus_cucurbitae  ======================================================================
                     M. domestica  ======================================================================
               Teleopsis_dalmanni  ======================================================================
    Scaptodrosophila_lebanonensis  ======================================================================
                     T. castaneum  ======================================================================
                        D_montana  ======================================================================

                   D. melanogaster  --------------------------------------------------------tc-tc---------
                       D. simulans  --------------------------------------------------------tc-tc---------
                      D. sechellia  --------------------------------------------------------tc-tc---------
                         D. erecta  --------------------------------------------------------tc-tc---------
                         D. yakuba  --------------------------------------------------------tc-tc---------
                     D. ficusphila  ----------------------------------------------------------------------
                     D. eugracilis  --------------------------------------------------------tcatt---------
                      D. biarmipes  --------------------------------------------------------gc-tc---------
                        D. suzukii  --------------------------------------------------------gc-tc---------
                     D. takahashii  --------------------------------------------------------tc-tc---------
                        D. elegans  --------------------------------------------------------tc-tctctcttgcc
                       D. rhopaloa  --------------------------------------------------------tc-tc------ggt
                         D_serrata  --------------------------------------------------------gc-tc---------
                       D. kikkawai  --------------------------------------------------------gc-tc---------
                      D. ananassae  --------------------------------------------------------gc-tc---------
                    D. bipectinata  --------------------------------------------------------ac-tc---------
                       D_americana  --------------------------------------------------------gt-gc---------
                    D_novamexicana  --------------------------------------------------------gt-gc---------
                        D. virilis  --------------------------------------------------------gt-gc---------
                        D_arizonae  --------------------------------------------------------gt-tc---------
                     D. mojavensis  --------------------------------------------------------gt-tc---------
                           D_hydei  --------------------------------------------------------gc-tc---------
                      D. grimshawi  --------------------------------------------------------tg-tc---------
                       D_athabasca  --------------------------------------------------------tc-tc---------
                 D_pseudoobscura_1  ----------ctcgcgccctcactcgcctgctgactgaaatccattcaat------cc-gc---------
                        D. miranda  gctgactgaa-----------------------------atccattcaatccgctctc-tc---------
                     D. persimilis  --------------------------------------------------------tc-tc---------
                  D. pseudoobscura  --------------------------------------------------------tc-tc---------
                      D_subobscura  --------------------------------------------------------tc-tc---------
                         D_obscura  --------------------------------------------------------tc-tc---------
                Zaprionus_indianus  --------------------------------------------------------tc-tc---------
                          D_nasuta  --------------------------------------------------------ac-tc---------
                     D. albomicans  --------------------------------------------------------ac-tc---------
                Ceratitis_capitata  -------------------------------------------------------gct-cc---------
                  Ephydra_gracilis  -------------------------------------------------------act-cc---------
                     D. willistoni  ======================================================================
                      A_arabiensis  ======================================================================
         Proctacanthus_coquilletti  ======================================================================
                 Bactrocera_tryoni  ======================================================================
                Belgica_antarctica  ======================================================================
             Culicoides_sonorensis  ======================================================================
                      A. mellifera  ======================================================================
             Lutzomyia_longipalpis  ======================================================================
                Chironomus_tentans  ======================================================================
                         A_farauti  ======================================================================
               Stomoxys_calcitrans  ======================================================================
                  Bactrocera_oleae  ======================================================================
                   Lucilia_cuprina  ======================================================================
              Bactrocera_latifrons  ======================================================================
               Bactrocera_dorsalis  ======================================================================
             Zeugodacus_cucurbitae  ======================================================================
                      M. domestica  ======================================================================
                Teleopsis_dalmanni  ======================================================================
     Scaptodrosophila_lebanonensis  ======================================================================
                      T. castaneum  ======================================================================
                         D_montana  ======================================================================

                   D. melanogaster  tctct--------ctt----gacc--------tg------------cgct-------------------c
                       D. simulans  tctct--------ctt----gacc--------tg------------cg---------------------c
                      D. sechellia  tctct--------ctt----gacc--------tg------------cg---------------------c
                         D. erecta  cctct--------ctt----gacc--------tg------------cgct-------------------c
                         D. yakuba  cctct--------ctt----gacc--------tg------------cg---------------------c
                     D. ficusphila  ---ct--------ctc----gtcc--------tg------------cg---------------------c
                     D. eugracilis  gctct--------ctt----gtcc--------tg------------cg---------------------c
                      D. biarmipes  tctct--------ctc----gtcc--------tg------------cg---------------------c
                        D. suzukii  tctct--------ctc----gtcc--------tg------------cg---------------------c
                     D. takahashii  tctct--------ctc----gtcc--------tg------------cg---------------------c
                        D. elegans  tctct--------ctctttggtcc--------tg------------cgctt-----------------tc
                       D. rhopaloa  tctct--------ctc----gtcc--------tg------------cg---------------------c
                         D_serrata  tcttt--------cgg----gtgc--------cg------------cc---------------------c
                       D. kikkawai  tcttt--------cgg----gtgc--------cg------------cc---------------------c
                      D. ananassae  tctct--------gtc----gcgccctgttcgtg------------cg---------------------c
                    D. bipectinata  tctct--------gtc----gcgccctgtt--tg------------cg---------------------c
                       D_americana  tccgtgctccgtgctc----attc--------ac------------tctccctc--------------tc
                    D_novamexicana  tccgtgctccgtgctc----attc--------ac------------tctccatc--------------tc
                        D. virilis  tccgtgctccgtgctc----attc--------ac------------tctccctc--------------tc
                        D_arizonae  tccgt--------ctc----catc--------ac------------tctcccac--------------tc
                     D. mojavensis  tccgt--------ctc----catc--------tc------------tctctatc--------------tc
                           D_hydei  tccgt--------ctc----catc--------ac------------tctgtctc--------------tt
                      D. grimshawi  tctgt--------gtg----tttc--------ta------------tctattac--------------tc
                       D_athabasca  tatct--------ttc----tgtc--------tg------------tctttgca--------------tc
                 D_pseudoobscura_1  tctct--------ctc----tctt--------tgcctgtgtgttg-tgtttgc---------------tt
                        D. miranda  tctct--------ctc----tctt--------tgcctgtgtgttg-tgtttgc---------------tt
                     D. persimilis  tatct--------ctc----ggtc--------ggtctttgcatcgctctctctc--------------tc
                  D. pseudoobscura  tatct--------ctc----tgtc--------tg------------tctttgca--------------tc
                      D_subobscura  tatct--------ctc----tgtc--------tg------------tctttgca--------------tc
                         D_obscura  tatct--------cac----tgtc--------tg------------tctttgca--------------tc
                Zaprionus_indianus  tctcg--------ctc------------------------------tcttaaag--------------tc
                          D_nasuta  tctcg--------cat----ttgt--------ta------------tgtttgct--------------tt
                     D. albomicans  tctcg--------cat----ttgt--------ta------------tgtttgct--------------tt
                Ceratitis_capitata  tgttc--------cat----aata--------ta------------c---------------------tt
                  Ephydra_gracilis  ttttt--------tac----cacc--------tc------------ctttcgttatgaattatttttgtt
                     D. willistoni  ======================================================================
                      A_arabiensis  ======================================================================
         Proctacanthus_coquilletti  ======================================================================
                 Bactrocera_tryoni  ======================================================================
                Belgica_antarctica  ======================================================================
             Culicoides_sonorensis  ======================================================================
                      A. mellifera  ======================================================================
             Lutzomyia_longipalpis  ======================================================================
                Chironomus_tentans  ======================================================================
                         A_farauti  ======================================================================
               Stomoxys_calcitrans  ======================================================================
                  Bactrocera_oleae  ======================================================================
                   Lucilia_cuprina  ======================================================================
              Bactrocera_latifrons  ======================================================================
               Bactrocera_dorsalis  ======================================================================
             Zeugodacus_cucurbitae  ======================================================================
                      M. domestica  ======================================================================
                Teleopsis_dalmanni  ======================================================================
     Scaptodrosophila_lebanonensis  ======================================================================
                      T. castaneum  ======================================================================
                         D_montana  ======================================================================

                   D. melanogaster  tctctct---------tt
                       D. simulans  tctctct---------tt
                      D. sechellia  tctctct---------tt
                         D. erecta  tctctct---------gt
                         D. yakuba  tctctct---------gt
                     D. ficusphila  tctctct---------ct
                     D. eugracilis  tctctct---------ct
                      D. biarmipes  gctctct---------c-
                        D. suzukii  gctctct---------t-
                     D. takahashii  tctctct---------tt
                        D. elegans  tctctct---------c-
                       D. rhopaloa  tctctct---------c-
                         D_serrata  gctctcg---------ct
                       D. kikkawai  gctcgcg---------ct
                      D. ananassae  tctctct---------ct
                    D. bipectinata  tct---------------
                       D_americana  tcgctct-----------
                    D_novamexicana  tcgctct-----------
                        D. virilis  t--ctct-----------
                        D_arizonae  tgtcttt-----------
                     D. mojavensis  tgtcctt-----------
                           D_hydei  tctccct-----------
                      D. grimshawi  gcgctct-----------
                       D_athabasca  gctctct-----------
                 D_pseudoobscura_1  gctctct-----------
                        D. miranda  gctctct-----------
                     D. persimilis  gcgccct-----------
                  D. pseudoobscura  gctctct-----------
                      D_subobscura  gctctct-----------
                         D_obscura  gctctct-----------
                Zaprionus_indianus  gctctca-----------
                          D_nasuta  gcgctctctgctctct--
                     D. albomicans  gcgctctctgctctct--
                Ceratitis_capitata  g-----------------
                  Ephydra_gracilis  g-----------------
                     D. willistoni  ==================
                      A_arabiensis  ==================
         Proctacanthus_coquilletti  ==================
                 Bactrocera_tryoni  ==================
                Belgica_antarctica  ==================
             Culicoides_sonorensis  ==================
                      A. mellifera  ==================
             Lutzomyia_longipalpis  ==================
                Chironomus_tentans  ==================
                         A_farauti  ==================
               Stomoxys_calcitrans  ==================
                  Bactrocera_oleae  ==================
                   Lucilia_cuprina  ==================
              Bactrocera_latifrons  ==================
               Bactrocera_dorsalis  ==================
             Zeugodacus_cucurbitae  ==================
                      M. domestica  ==================
                Teleopsis_dalmanni  ==================
     Scaptodrosophila_lebanonensis  ==================
                      T. castaneum  ==================
                         D_montana  ==================

Inserts between block 17 and 18 in window
                        D_serrata 3bp
                      D. kikkawai 3bp
                       D_arizonae 19bp
                    D. mojavensis 2764bp
                          D_hydei 4bp
                     D. grimshawi 13bp
                      D_athabasca 6bp
                D_pseudoobscura_1 8bp
                       D. miranda 8bp
B D                 D. persimilis 6bp
                 D. pseudoobscura 4bp
                     D_subobscura 8bp
                        D_obscura 8bp
               Zaprionus_indianus 8bp

Alignment block 18 of 1353 in window, 826619 - 826622, 4 bps 
B D                D. melanogaster  atct
  D                    D. simulans  ctct
B D                   D. sechellia  ctct
                         D. erecta  ctct
                         D. yakuba  ctcc
                     D. ficusphila  ctct
                         D_serrata  cgct
                       D. kikkawai  ctct
                      D. ananassae  ctct
                       D_americana  ttct
                    D_novamexicana  ttct
                        D. virilis  ttct
                        D_arizonae  --ct
                           D_hydei  tgct
                      D. grimshawi  ttct
                 D_pseudoobscura_1  agca
                        D. miranda  agca
                      D_subobscura  ctca
                         D_obscura  ctcc
                Zaprionus_indianus  gttt
                          D_nasuta  gtca
                     D. albomicans  gtca
                Ceratitis_capitata  ttca
                  Ephydra_gracilis  ttct
                    D. willistoni  ====
                      D_athabasca  ====
                 D. pseudoobscura  ====
                     D. biarmipes  ----
                    D. mojavensis  ====
                     A_arabiensis  ====
        Proctacanthus_coquilletti  ====
                Bactrocera_tryoni  ====
               Belgica_antarctica  ====
            Culicoides_sonorensis  ====
                     A. mellifera  ====
            Lutzomyia_longipalpis  ====
               Chironomus_tentans  ====
                        A_farauti  ====
              Stomoxys_calcitrans  ====
                 Bactrocera_oleae  ====
                  Lucilia_cuprina  ====
             Bactrocera_latifrons  ====
              Bactrocera_dorsalis  ====
            Zeugodacus_cucurbitae  ====
                     M. domestica  ====
                      D. rhopaloa  ----
                    D. takahashii  ----
                    D. eugracilis  ----
                   D. bipectinata  ----
B D                  D. persimilis  ====
                       D. elegans  ----
               Teleopsis_dalmanni  ====
    Scaptodrosophila_lebanonensis  ====
                     T. castaneum  ====
                        D_montana  ====
                       D. suzukii  ----

Inserts between block 18 and 19 in window
                      D_americana 7bp
                   D_novamexicana 7bp
                       D. virilis 7bp
                       D_arizonae 1517bp
                          D_hydei 3bp
                     D. grimshawi 5bp
                         D_nasuta 6bp
                    D. albomicans 6bp

Alignment block 19 of 1353 in window, 826623 - 826633, 11 bps 
B D                D. melanogaster  cgccc----tcgt----ca-----------
  D                    D. simulans  cgccc----tcgt----ca-----------
B D                   D. sechellia  cgccc----tcgt----ca-----------
                         D. erecta  cgccc----tcgt----ca-----------
                         D. yakuba  cgccc----tcgt----ca-----------
                     D. ficusphila  ----c----tcgc----ca-----------
                     D. eugracilis  ----c----tcgt----ca-----------
                     D. takahashii  ----c----gcat----ca-----------
                        D. elegans  -----------ac----ca-----------
                       D. rhopaloa  -----------gc----ca-----------
                         D_serrata  ctctc----tcgcaaagca-----------
                       D. kikkawai  ctcgcgag-tcgcaaagca-----------
                      D. ananassae  cgctcctggccac----ca-----------
                    D. bipectinata  --ctcctgcccac----ca-----------
                      D_subobscura  ------------------c-----------
                         D_obscura  ------------------c-----------
                Zaprionus_indianus  ------------------g-----------
                Ceratitis_capitata  -----------------tactctccaattc
                  Ephydra_gracilis  -----------------tgctgtt--atta
                    D. willistoni  ==============================
                     D. grimshawi  ==============================
                       D. miranda  ------------------------------
                      D_athabasca  ==============================
                 D. pseudoobscura  ==============================
                     D. biarmipes  ------------------------------
                       D_arizonae  ==============================
                    D. mojavensis  ==============================
                       D. virilis  ==============================
                   D_novamexicana  ==============================
                    D. albomicans  ==============================
                         D_nasuta  ==============================
                     A_arabiensis  ==============================
        Proctacanthus_coquilletti  ==============================
                Bactrocera_tryoni  ==============================
               Belgica_antarctica  ==============================
            Culicoides_sonorensis  ==============================
                     A. mellifera  ==============================
            Lutzomyia_longipalpis  ==============================
               Chironomus_tentans  ==============================
                        A_farauti  ==============================
              Stomoxys_calcitrans  ==============================
                 Bactrocera_oleae  ==============================
                  Lucilia_cuprina  ==============================
             Bactrocera_latifrons  ==============================
              Bactrocera_dorsalis  ==============================
            Zeugodacus_cucurbitae  ==============================
                      D_americana  ==============================
                     M. domestica  ==============================
                D_pseudoobscura_1  ------------------------------
                          D_hydei  ==============================
B D                  D. persimilis  ==============================
               Teleopsis_dalmanni  ==============================
    Scaptodrosophila_lebanonensis  ==============================
                     T. castaneum  ==============================
                        D_montana  ==============================
                       D. suzukii  ------------------------------

Inserts between block 19 and 20 in window
                     D_subobscura 3bp
                        D_obscura 9bp
               Zaprionus_indianus 9bp
               Ceratitis_capitata 1bp

Alignment block 20 of 1353 in window, 826634 - 826650, 17 bps 
B D                D. melanogaster  cctggtggtgc---gtagtc
  D                    D. simulans  cctggtggtgc---gtagtc
B D                   D. sechellia  cctggtggtgc---gtagtc
                         D. erecta  cctggtggtgt---tgagtc
                         D. yakuba  cctgggggtgc---ggagtc
                     D. ficusphila  cctggtggtgc---aaagtc
                     D. eugracilis  cctggtggtgc---gtagtc
                     D. takahashii  cctggtggt--------gtc
                        D. elegans  cctggtggtgc---gtagtc
                       D. rhopaloa  cctggttgtgc---gtagtc
                         D_serrata  cctggtggtgcaaagaagtc
                       D. kikkawai  cctggtggtgcaaagaagtc
                      D. ananassae  cctggtggtgc---aaaggc
                    D. bipectinata  cctggtggtgc---aaaggc
                       D_americana  tcttcaaaatc---gttcgt
                    D_novamexicana  tctttaaaatc---gctcgt
                        D. virilis  tcttaaaaatc---gctcgt
                           D_hydei  tcttaaaaagt---gttcgt
                      D. grimshawi  tct----------------c
                 D_pseudoobscura_1  cctggtggtgc---gtacgc
                        D. miranda  cctggtggtgc---gtacgc
B D                  D. persimilis  cctgctgacag---aaatcc
                      D_subobscura  cctgctgactg---agtc--
                         D_obscura  tttggcagtgt---gttgta
                Zaprionus_indianus  cgttacgttgc---ctgcct
                          D_nasuta  tcacacatagc---attgct
                     D. albomicans  tcacacatagc---attgct
                Ceratitis_capitata  attgttggtat---atactc
                    D. willistoni  ====================
                      D_athabasca  ====================
                 D. pseudoobscura  ====================
                     D. biarmipes  --------------------
                       D_arizonae  ====================
                    D. mojavensis  ====================
                     A_arabiensis  ====================
        Proctacanthus_coquilletti  ====================
                Bactrocera_tryoni  ====================
               Belgica_antarctica  ====================
            Culicoides_sonorensis  ====================
                     A. mellifera  ====================
            Lutzomyia_longipalpis  ====================
               Chironomus_tentans  ====================
                        A_farauti  ====================
              Stomoxys_calcitrans  ====================
                 Bactrocera_oleae  ====================
                  Lucilia_cuprina  ====================
             Bactrocera_latifrons  ====================
              Bactrocera_dorsalis  ====================
            Zeugodacus_cucurbitae  ====================
                     M. domestica  ====================
               Teleopsis_dalmanni  ====================
    Scaptodrosophila_lebanonensis  ====================
                     T. castaneum  ====================
                        D_montana  ====================
                       D. suzukii  --------------------

Inserts between block 20 and 21 in window
               Ceratitis_capitata 25726bp

Alignment block 21 of 1353 in window, 826651 - 826655, 5 bps 
B D                D. melanogaster  c-----------tttg
  D                    D. simulans  c-----------tttg
B D                   D. sechellia  c-----------tttg
                         D. erecta  c-----------tttg
                         D. yakuba  c-----------tttg
                     D. ficusphila  c-----------tttg
                     D. eugracilis  c-----------tttc
                     D. takahashii  c---------------
                        D. elegans  c-----------t---
                       D. rhopaloa  c---------------
                         D_serrata  c---------------
                       D. kikkawai  c---------------
                      D. ananassae  c---------------
                    D. bipectinata  c---------------
                       D_americana  a-----------tttg
                    D_novamexicana  a-----------tttg
                        D. virilis  a-----------tttg
                           D_hydei  a-----------tttg
                      D. grimshawi  a-----------tttg
                 D_pseudoobscura_1  a-----------ttta
                        D. miranda  a-----------tttg
B D                  D. persimilis  a-----------ttca
                         D_obscura  t-----------ttgc
                Zaprionus_indianus  g-----------tcct
                          D_nasuta  agcggagcgcagtttg
                     D. albomicans  agcggagcgcagtttg
                    D. willistoni  ================
                      D_athabasca  ================
                 D. pseudoobscura  ================
                     D. biarmipes  ----------------
                       D_arizonae  ================
                    D. mojavensis  ================
                     A_arabiensis  ================
        Proctacanthus_coquilletti  ================
                Bactrocera_tryoni  ================
               Belgica_antarctica  ================
            Culicoides_sonorensis  ================
                     A. mellifera  ================
            Lutzomyia_longipalpis  ================
               Chironomus_tentans  ================
                        A_farauti  ================
              Stomoxys_calcitrans  ================
                 Bactrocera_oleae  ================
               Ceratitis_capitata  ================
                  Lucilia_cuprina  ================
             Bactrocera_latifrons  ================
              Bactrocera_dorsalis  ================
            Zeugodacus_cucurbitae  ================
                     M. domestica  ================
                     D_subobscura  ----------------
               Teleopsis_dalmanni  ================
    Scaptodrosophila_lebanonensis  ================
                     T. castaneum  ================
                        D_montana  ================
                       D. suzukii  ----------------

Inserts between block 21 and 22 in window
                      D_americana 4bp
                   D_novamexicana 4bp
                       D. virilis 4bp
                          D_hydei 5bp
                     D. grimshawi 5174bp
                         D_nasuta 4bp
                    D. albomicans 4bp

Alignment block 22 of 1353 in window, 826656 - 826657, 2 bps 
B D                D. melanogaster  ----------------gc-
  D                    D. simulans  ----------------gc-
B D                   D. sechellia  ----------------gc-
                         D. erecta  ----------------gt-
                         D. yakuba  ----------------gt-
                     D. ficusphila  ----------------g--
                     D. eugracilis  ----------------gc-
                        D. elegans  -----------------t-
                       D. rhopaloa  -----------------t-
                       D_americana  gtttggttatac---tat-
                    D_novamexicana  gtttggttatac---tat-
                        D. virilis  gtttggttatac---tat-
                           D_hydei  -tttggttttac---tac-
                       D_athabasca  ---------------cgc-
                 D_pseudoobscura_1  -----------c---cgct
                        D. miranda  -----------c---cgct
B D                  D. persimilis  -----------atc-cgc-
                  D. pseudoobscura  ---------------cgc-
                      D_subobscura  ---------------cgc-
                         D_obscura  -----------t---tgc-
                Zaprionus_indianus  -----------ctctcgc-
                          D_nasuta  --------------gcac-
                     D. albomicans  --------------gcac-
                    D. willistoni  ===================
                     D. grimshawi  ===================
                     D. ananassae  -------------------
                     D. biarmipes  -------------------
                       D_arizonae  ===================
                    D. mojavensis  ===================
                     A_arabiensis  ===================
        Proctacanthus_coquilletti  ===================
                Bactrocera_tryoni  ===================
               Belgica_antarctica  ===================
            Culicoides_sonorensis  ===================
                     A. mellifera  ===================
            Lutzomyia_longipalpis  ===================
               Chironomus_tentans  ===================
                        A_farauti  ===================
              Stomoxys_calcitrans  ===================
                 Bactrocera_oleae  ===================
               Ceratitis_capitata  ===================
                  Lucilia_cuprina  ===================
             Bactrocera_latifrons  ===================
              Bactrocera_dorsalis  ===================
            Zeugodacus_cucurbitae  ===================
                     M. domestica  ===================
                    D. takahashii  -------------------
                      D. kikkawai  -------------------
                   D. bipectinata  -------------------
               Teleopsis_dalmanni  ===================
    Scaptodrosophila_lebanonensis  ===================
                     T. castaneum  ===================
                        D_serrata  -------------------
                        D_montana  ===================
                       D. suzukii  -------------------

Alignment block 23 of 1353 in window, 826658 - 826675, 18 bps 
B D                D. melanogaster  tc-ggtccaccaccc---------gccc
  D                    D. simulans  tc-ggtccaccaccc---------tcct
B D                   D. sechellia  tc-ggtccaccaccc---------tccc
                         D. erecta  tc-ggtccaccaccc---------tccc
                         D. yakuba  tc-ggtccaccaccc---------tccc
                     D. ficusphila  ------ccaccaccc---------tc--
                     D. eugracilis  tctggtccaccaccc---------tc--
                      D. biarmipes  ---cgtccgccaccc----------c--
                        D. suzukii  ---cgtccaccaccc----------c--
                     D. takahashii  tg-tgtccaccaccc----------c--
                        D. elegans  tt-ggtccaccaccc---------ct--
                       D. rhopaloa  tt-ggtccaccaccc---------tc--
                         D_serrata  ---tctcagtgtccc-------------
                       D. kikkawai  ---tctccgtggccc-------------
                      D. ananassae  tc-ggtgggcg-----------------
                    D. bipectinata  tc-ggtgggcg-----------------
                       D_americana  tc-tccc---------------------
                    D_novamexicana  tc-tccc---------------------
                        D. virilis  tc-tccc---------------------
                           D_hydei  tc-tctc---------------------
                       D_athabasca  gc-tcgc---------------------
                 D_pseudoobscura_1  gc-tctc---------------------
                        D. miranda  gc-tctc---------------------
B D                  D. persimilis  tc-tctc---------------------
                  D. pseudoobscura  gc-cctc---------------------
                      D_subobscura  tc-tctc---------------------
                         D_obscura  tc-tctc---------------------
                Zaprionus_indianus  tc-tcgc---------------------
                          D_nasuta  gc-tctt---------------------
                     D. albomicans  gc-tctt---------------------
                      A_arabiensis  tc-ggaccgccgctcggtgctggccc--
                    D. willistoni  ============================
                     D. grimshawi  ============================
                       D_arizonae  ============================
                    D. mojavensis  ============================
        Proctacanthus_coquilletti  ============================
                Bactrocera_tryoni  ============================
               Belgica_antarctica  ============================
            Culicoides_sonorensis  ============================
                     A. mellifera  ============================
            Lutzomyia_longipalpis  ============================
               Chironomus_tentans  ============================
                        A_farauti  ============================
              Stomoxys_calcitrans  ============================
                 Bactrocera_oleae  ============================
               Ceratitis_capitata  ============================
                  Lucilia_cuprina  ============================
             Bactrocera_latifrons  ============================
              Bactrocera_dorsalis  ============================
            Zeugodacus_cucurbitae  ============================
                     M. domestica  ============================
               Teleopsis_dalmanni  ============================
    Scaptodrosophila_lebanonensis  ============================
                     T. castaneum  ============================
                        D_montana  ============================

Inserts between block 23 and 24 in window
                      D_americana 260bp
                   D_novamexicana 261bp
                       D. virilis 263bp
                          D_hydei 5304bp
                      D_athabasca 15bp
                D_pseudoobscura_1 26bp
                       D. miranda 26bp
B D                 D. persimilis 20bp
                 D. pseudoobscura 11bp
                     D_subobscura 24bp
                        D_obscura 17bp
               Zaprionus_indianus 5bp
                         D_nasuta 21bp
                    D. albomicans 21bp

Alignment block 24 of 1353 in window, 826676 - 826699, 24 bps 
B D                D. melanogaster  agtgggcg------gt------------g---------ctgcaacccttag---
  D                    D. simulans  agtgggcg------gt------------g---------ctgcaacccttag---
B D                   D. sechellia  agtgggcg------gt------------g---------ctgcaacccttag---
                         D. erecta  agtgggcg------gt------------g---------cagcaacccttaa---
                         D. yakuba  agtgggcg------gt------------g---------ctgcaacccttag---
                     D. ficusphila  agtgggtg------gt------------------------acaacccttaa---
                     D. eugracilis  aatgggtg------gc------------ggtgc-tatactgcaacccttaa---
                      D. biarmipes  actgggtg------gcgctgccgg----g---------ctgcaacccttaa---
                        D. suzukii  agtgggtg------gcgctgccgg----g---------ctgcaacccttaa---
                     D. takahashii  agtgggtg------gcggtagtcgtaccg---------ctgcaacccttaa---
                        D. elegans  ggtgggtg------gcggt---------g---------ctgcaacccttaa---
                       D. rhopaloa  agtgggtg------gcggt---------g---------ctgcaacccttaa---
                         D_serrata  agtgggtg------gcggcgatgg----c---------ctgcaaccctt-----
                       D. kikkawai  agtgggtg------gcggctttgg----c---------ctgcaaccctt-----
                      D. ananassae  ggtgggcgccccgtgt------------c---------ctgcaacccttag---
                    D. bipectinata  ggtgggcgccccgtgt------------c---------ctgcaacccttag---
                       D_athabasca  gactga------------------------------------------------
                 D_pseudoobscura_1  ggcagg------------------------------------------------
                        D. miranda  ggcagg------------------------------------------------
B D                  D. persimilis  gtttga------------------------------------------------
                  D. pseudoobscura  gactga------------------------------------------------
                      D_subobscura  gtttgc------------------------------------------------
                         D_obscura  ggtgcg------------------------------------------------
                          D_nasuta  gccagg------------------------------------------------
                     D. albomicans  gccagg------------------------------------------------
                      A_arabiensis  ------------------------------tgtgggcgatgctaccggcggttg
                    D. willistoni  ======================================================
                     D. grimshawi  ======================================================
                       D_arizonae  ======================================================
                    D. mojavensis  ======================================================
                       D. virilis  ======================================================
                   D_novamexicana  ======================================================
        Proctacanthus_coquilletti  ======================================================
                Bactrocera_tryoni  ======================================================
               Belgica_antarctica  ======================================================
            Culicoides_sonorensis  ======================================================
                     A. mellifera  ======================================================
            Lutzomyia_longipalpis  ======================================================
               Chironomus_tentans  ======================================================
                        A_farauti  ======================================================
              Stomoxys_calcitrans  ======================================================
                 Bactrocera_oleae  ======================================================
               Ceratitis_capitata  ======================================================
                  Lucilia_cuprina  ======================================================
             Bactrocera_latifrons  ======================================================
              Bactrocera_dorsalis  ======================================================
            Zeugodacus_cucurbitae  ======================================================
                      D_americana  ======================================================
                     M. domestica  ======================================================
                          D_hydei  ======================================================
               Teleopsis_dalmanni  ======================================================
               Zaprionus_indianus  ======================================================
    Scaptodrosophila_lebanonensis  ======================================================
                     T. castaneum  ======================================================
                        D_montana  ======================================================

Inserts between block 24 and 25 in window
                      D_athabasca 3bp
                D_pseudoobscura_1 4bp
                       D. miranda 4bp
B D                 D. persimilis 4bp
                 D. pseudoobscura 4bp
                     D_subobscura 4bp
                        D_obscura 4bp
                         D_nasuta 9bp
                    D. albomicans 9bp

Alignment block 25 of 1353 in window, 826700 - 826706, 7 bps 
B D                D. melanogaster  --ccctccg
  D                    D. simulans  --ccctccg
B D                   D. sechellia  --ccctccg
                         D. erecta  --ccctccg
                         D. yakuba  --ccctccg
                     D. ficusphila  --ccctcgg
                     D. eugracilis  --cactcgc
                      D. biarmipes  --ccctcgc
                        D. suzukii  --ccctcgc
                     D. takahashii  --ccctcgg
                        D. elegans  --ccctcgg
                       D. rhopaloa  --ccctcga
                         D_serrata  --------g
                       D. kikkawai  --------g
                      D. ananassae  --ccg----
                    D. bipectinata  --ccg----
                       D_americana  --ccttcc-
                    D_novamexicana  --ccttcc-
                        D. virilis  --ccttcc-
                       D_athabasca  --cattaa-
                 D_pseudoobscura_1  --cattca-
                        D. miranda  --cattca-
B D                  D. persimilis  --tctctc-
                  D. pseudoobscura  --cattca-
                      D_subobscura  --tctctc-
                         D_obscura  --cattta-
                          D_nasuta  --catacg-
                     D. albomicans  --catacg-
                      A_arabiensis  cgccagc--
                    D. willistoni  =========
                     D. grimshawi  =========
                       D_arizonae  =========
                    D. mojavensis  =========
        Proctacanthus_coquilletti  =========
                Bactrocera_tryoni  =========
               Belgica_antarctica  =========
            Culicoides_sonorensis  =========
                     A. mellifera  =========
            Lutzomyia_longipalpis  =========
               Chironomus_tentans  =========
                        A_farauti  =========
              Stomoxys_calcitrans  =========
                 Bactrocera_oleae  =========
               Ceratitis_capitata  =========
                  Lucilia_cuprina  =========
             Bactrocera_latifrons  =========
              Bactrocera_dorsalis  =========
            Zeugodacus_cucurbitae  =========
                     M. domestica  =========
                          D_hydei  =========
               Teleopsis_dalmanni  =========
               Zaprionus_indianus  =========
    Scaptodrosophila_lebanonensis  =========
                     T. castaneum  =========
                        D_montana  =========

Inserts between block 25 and 26 in window
                      D_americana 1bp
                   D_novamexicana 1bp
                       D. virilis 1bp
                      D_athabasca 7bp
                D_pseudoobscura_1 37bp
                       D. miranda 37bp
B D                 D. persimilis 972bp
                 D. pseudoobscura 5bp
                        D_obscura 6bp

Alignment block 26 of 1353 in window, 826707 - 826716, 10 bps 
B D                D. melanogaster  ctttccatca
  D                    D. simulans  cttcccatca
B D                   D. sechellia  cttctcatca
                         D. erecta  cttcccatca
                         D. yakuba  cttcccatca
                     D. ficusphila  cttcccatca
                     D. eugracilis  cttcccatca
                      D. biarmipes  ctgcccatca
                        D. suzukii  ctccccatca
                     D. takahashii  cttcccatca
                        D. elegans  cttcccatca
                       D. rhopaloa  cttcccatca
                         D_serrata  tgtcccgtca
                       D. kikkawai  tggcccgtca
                      D. ananassae  ----ccgtca
                    D. bipectinata  ----ccgtca
                       D_americana  ccttggctcg
                    D_novamexicana  ccttggctcg
                        D. virilis  ccttgtctcg
                 D_pseudoobscura_1  -ttttcctaa
                        D. miranda  -ttttcctaa
                         D_obscura  ctctccctcg
                Zaprionus_indianus  ctctccctca
                          D_nasuta  ------c---
                     D. albomicans  ------c---
                      A_arabiensis  ttctcgatca
                    D. willistoni  ==========
                     D. grimshawi  ==========
                      D_athabasca  ==========
                 D. pseudoobscura  ==========
                       D_arizonae  ==========
                    D. mojavensis  ==========
        Proctacanthus_coquilletti  ==========
                Bactrocera_tryoni  ==========
               Belgica_antarctica  ==========
            Culicoides_sonorensis  ==========
                     A. mellifera  ==========
            Lutzomyia_longipalpis  ==========
               Chironomus_tentans  ==========
                        A_farauti  ==========
              Stomoxys_calcitrans  ==========
                 Bactrocera_oleae  ==========
               Ceratitis_capitata  ==========
                  Lucilia_cuprina  ==========
             Bactrocera_latifrons  ==========
              Bactrocera_dorsalis  ==========
            Zeugodacus_cucurbitae  ==========
                     M. domestica  ==========
                     D_subobscura  ----------
                          D_hydei  ==========
B D                  D. persimilis  ==========
               Teleopsis_dalmanni  ==========
    Scaptodrosophila_lebanonensis  ==========
                     T. castaneum  ==========
                        D_montana  ==========

Inserts between block 26 and 27 in window
                D_pseudoobscura_1 5bp
                       D. miranda 5bp
                        D_obscura 49bp
               Zaprionus_indianus 7bp

Alignment block 27 of 1353 in window, 826717 - 826727, 11 bps 
B D                D. melanogaster  cc-tttttttgg-
  D                    D. simulans  cc-attttttgg-
B D                   D. sechellia  cc-attttttgg-
                         D. erecta  cc-tttttttgg-
                         D. yakuba  cc-tttttttgg-
                     D. ficusphila  cc--ttttttgg-
                     D. eugracilis  cc-tttttttgg-
                      D. biarmipes  cc-tttttcggg-
                        D. suzukii  cc-ttttttcgg-
                     D. takahashii  ccttttttccgg-
                        D. elegans  ccttttttttgg-
                       D. rhopaloa  ccttttttttgg-
                         D_serrata  cc--ttttttgg-
                       D. kikkawai  cc-tttttttgg-
                      D. ananassae  ct---ttttcgg-
                    D. bipectinata  ca---ttttcgg-
                       D_americana  ---cagtttttg-
                    D_novamexicana  ---cagtttttg-
                        D. virilis  ---cagtttttg-
                       D_athabasca  ---ctctcttt--
                 D_pseudoobscura_1  ---ctttttttt-
                        D. miranda  ---ctttttttt-
                  D. pseudoobscura  ---ctctctctc-
                      D_subobscura  ---------ctt-
                Zaprionus_indianus  ---ctctctctg-
                          D_nasuta  -----------g-
                     D. albomicans  -----------g-
                      A_arabiensis  --ccatcgacggc
                    D. willistoni  =============
                     D. grimshawi  =============
                       D_arizonae  =============
                    D. mojavensis  =============
        Proctacanthus_coquilletti  =============
                Bactrocera_tryoni  =============
               Belgica_antarctica  =============
            Culicoides_sonorensis  =============
                     A. mellifera  =============
            Lutzomyia_longipalpis  =============
               Chironomus_tentans  =============
                        A_farauti  =============
              Stomoxys_calcitrans  =============
                 Bactrocera_oleae  =============
               Ceratitis_capitata  =============
                  Lucilia_cuprina  =============
             Bactrocera_latifrons  =============
              Bactrocera_dorsalis  =============
            Zeugodacus_cucurbitae  =============
                     M. domestica  =============
                        D_obscura  =============
                          D_hydei  =============
B D                  D. persimilis  =============
               Teleopsis_dalmanni  =============
    Scaptodrosophila_lebanonensis  =============
                     T. castaneum  =============
                        D_montana  =============

Inserts between block 27 and 28 in window
                D_pseudoobscura_1 2bp
                       D. miranda 2bp
                 D. pseudoobscura 2bp
                     D_subobscura 2bp
               Zaprionus_indianus 858bp

Alignment block 28 of 1353 in window, 826728 - 826750, 23 bps 
B D                D. melanogaster  ------------gtaacc-atggtc--gtgtttac-ggc
  D                    D. simulans  ------------gtaacc-atggtc--gtgtttac-ggc
B D                   D. sechellia  ------------gtaacc-atggtc--gtgtttac-ggc
                         D. erecta  ------------gtaacc-atggtc--gtgtttac-ggc
                         D. yakuba  ------------gtaacc-atggtc--gtgtttac-ggc
                     D. ficusphila  ------------gtaacc-atggtcgtgtgttttc-agt
                     D. eugracilis  ------------gtaacc-atggtcgtgtgtttac-ggc
                      D. biarmipes  ------------gtaacc-atggtcgtgtgtttac-cgc
                        D. suzukii  ------------gtaacc-atggtcgtgtgtttac-cgc
                     D. takahashii  ------------gtaacc-atggtcgtgtgtttac-cgc
                        D. elegans  ------------gtaacc-atggtcgtgtgtttac-cgg
                       D. rhopaloa  ------------gtaacc-atggtcgtgtgtttac-ggg
                         D_serrata  ------------gtaacc-atggtc--gtgt------gt
                       D. kikkawai  ------------gtaacc-atggtc--gtgt------gc
                      D. ananassae  ------------gtaacc-atggtc--gtgttgac-ggc
                    D. bipectinata  ------------gtaacc-atggtc--gtgttgac-ggc
                       D_americana  ------------gtaacc-atggtcgtcgccatgc----
                    D_novamexicana  ------------gtaacc-atggtcgtcgccatgc----
                        D. virilis  ------------gtaacc-atggtcgtcgccatgc----
                       D_athabasca  ---------------gcctgt-gtgttgtgtttgc----
                 D_pseudoobscura_1  ------------gtagcccatggtctcgtgc---c----
                        D. miranda  ------------gtagcccatggtctcgtgc---c----
                  D. pseudoobscura  ------------tttgcctgt-gtgttgtgtttgc----
                      D_subobscura  ------------tcagcacctggtggtgcgtacgc----
                          D_nasuta  ------------atatgc-atatgcatgtgcatgtc---
                     D. albomicans  ------------atatgc-atatgcatgtgcatgtc---
                      A_arabiensis  tgctgcttgatcgcgctc-acggt---------------
                    D. willistoni  =======================================
                     D. grimshawi  =======================================
                       D_arizonae  =======================================
                    D. mojavensis  =======================================
        Proctacanthus_coquilletti  =======================================
                Bactrocera_tryoni  =======================================
               Belgica_antarctica  =======================================
            Culicoides_sonorensis  =======================================
                     A. mellifera  =======================================
            Lutzomyia_longipalpis  =======================================
               Chironomus_tentans  =======================================
                        A_farauti  =======================================
              Stomoxys_calcitrans  =======================================
                 Bactrocera_oleae  =======================================
               Ceratitis_capitata  =======================================
                  Lucilia_cuprina  =======================================
             Bactrocera_latifrons  =======================================
              Bactrocera_dorsalis  =======================================
            Zeugodacus_cucurbitae  =======================================
                     M. domestica  =======================================
                        D_obscura  =======================================
                          D_hydei  =======================================
B D                  D. persimilis  =======================================
               Teleopsis_dalmanni  =======================================
               Zaprionus_indianus  =======================================
    Scaptodrosophila_lebanonensis  =======================================
                     T. castaneum  =======================================
                        D_montana  =======================================

Inserts between block 28 and 29 in window
                      D_athabasca 17bp
                D_pseudoobscura_1 17bp
                       D. miranda 17bp
                 D. pseudoobscura 17bp
                     D_subobscura 149bp

Alignment block 29 of 1353 in window, 826751 - 826756, 6 bps 
B D                D. melanogaster  aaactg
  D                    D. simulans  taactg
B D                   D. sechellia  taactg
                         D. erecta  taactg
                         D. yakuba  taactg
                     D. ficusphila  taactg
                     D. eugracilis  taactg
                      D. biarmipes  taactg
                        D. suzukii  taactg
                     D. takahashii  taactg
                        D. elegans  taactg
                       D. rhopaloa  taactg
                         D_serrata  taactg
                       D. kikkawai  taactg
                      D. ananassae  taactg
                    D. bipectinata  taactg
                       D_americana  --acac
                    D_novamexicana  --acac
                        D. virilis  --acac
                       D_athabasca  ----ag
                 D_pseudoobscura_1  ----ag
                        D. miranda  ----ag
                  D. pseudoobscura  ----ag
                          D_nasuta  --tttg
                     D. albomicans  --tttg
                      A_arabiensis  gagctg
                    D. willistoni  ======
                     D. grimshawi  ======
                       D_arizonae  ======
                    D. mojavensis  ======
        Proctacanthus_coquilletti  ======
                Bactrocera_tryoni  ======
               Belgica_antarctica  ======
            Culicoides_sonorensis  ======
                     A. mellifera  ======
            Lutzomyia_longipalpis  ======
               Chironomus_tentans  ======
                        A_farauti  ======
              Stomoxys_calcitrans  ======
                 Bactrocera_oleae  ======
               Ceratitis_capitata  ======
                  Lucilia_cuprina  ======
             Bactrocera_latifrons  ======
              Bactrocera_dorsalis  ======
            Zeugodacus_cucurbitae  ======
                     M. domestica  ======
                        D_obscura  ======
                     D_subobscura  ======
                          D_hydei  ======
B D                  D. persimilis  ======
               Teleopsis_dalmanni  ======
               Zaprionus_indianus  ======
    Scaptodrosophila_lebanonensis  ======
                     T. castaneum  ======
                        D_montana  ======

Alignment block 30 of 1353 in window, 826757 - 826763, 7 bps 
B D                D. melanogaster  tgccacc-
  D                    D. simulans  tgccacc-
B D                   D. sechellia  tggcacc-
                         D. erecta  tgccacc-
                         D. yakuba  tgccacc-
                     D. ficusphila  tgcca-c-
                     D. eugracilis  tgccacc-
                      D. biarmipes  tgccacc-
                        D. suzukii  tgccacc-
                     D. takahashii  tgccacc-
                        D. elegans  tgccacc-
                       D. rhopaloa  tgccacc-
                         D_serrata  tgccatc-
                       D. kikkawai  tgccatc-
                      D. ananassae  tgccatc-
                    D. bipectinata  tgccatc-
                       D_americana  cgcccgcg
                    D_novamexicana  cgcccgcg
                        D. virilis  cgcccgcg
                       D_athabasca  cacctggt
                 D_pseudoobscura_1  cgcccgcc
                        D. miranda  cgcccgcc
                  D. pseudoobscura  cacctggt
                          D_nasuta  cgtgtgcg
                     D. albomicans  cgtgtgcg
                    D. willistoni  ========
                     D. grimshawi  ========
                       D_arizonae  ========
                    D. mojavensis  ========
        Proctacanthus_coquilletti  ========
                Bactrocera_tryoni  ========
               Belgica_antarctica  ========
            Culicoides_sonorensis  ========
                     A. mellifera  ========
            Lutzomyia_longipalpis  ========
               Chironomus_tentans  ========
                        A_farauti  ========
              Stomoxys_calcitrans  ========
                 Bactrocera_oleae  ========
               Ceratitis_capitata  ========
                  Lucilia_cuprina  ========
             Bactrocera_latifrons  ========
              Bactrocera_dorsalis  ========
            Zeugodacus_cucurbitae  ========
                     M. domestica  ========
                        D_obscura  ========
                     D_subobscura  ========
                          D_hydei  ========
B D                  D. persimilis  ========
               Teleopsis_dalmanni  ========
               Zaprionus_indianus  ========
    Scaptodrosophila_lebanonensis  ========
                     T. castaneum  ========
                        D_montana  ========

Inserts between block 30 and 31 in window
                        D_serrata 35bp
                      D. kikkawai 5bp
                     D. ananassae 2bp
                   D. bipectinata 2bp

Alignment block 31 of 1353 in window, 826764 - 826765, 2 bps 
B D                D. melanogaster  ga-
  D                    D. simulans  ga-
B D                   D. sechellia  ga-
                         D. erecta  ga-
                         D. yakuba  ga-
                     D. ficusphila  ga-
                     D. eugracilis  aa-
                      D. biarmipes  gg-
                        D. suzukii  ag-
                     D. takahashii  ga-
                        D. elegans  aa-
                       D. rhopaloa  aa-
                       D_americana  -gc
                    D_novamexicana  -gc
                        D. virilis  -gc
                       D_athabasca  -g-
                 D_pseudoobscura_1  -g-
                        D. miranda  -g-
                  D. pseudoobscura  -g-
                          D_nasuta  -ga
                     D. albomicans  -ga
                    D. willistoni  ===
                     D. grimshawi  ===
                     D. ananassae  ===
                       D_arizonae  ===
                    D. mojavensis  ===
        Proctacanthus_coquilletti  ===
                Bactrocera_tryoni  ===
               Belgica_antarctica  ===
            Culicoides_sonorensis  ===
                     A. mellifera  ===
            Lutzomyia_longipalpis  ===
               Chironomus_tentans  ===
                        A_farauti  ===
              Stomoxys_calcitrans  ===
                 Bactrocera_oleae  ===
               Ceratitis_capitata  ===
                  Lucilia_cuprina  ===
             Bactrocera_latifrons  ===
              Bactrocera_dorsalis  ===
            Zeugodacus_cucurbitae  ===
                     M. domestica  ===
                      D. kikkawai  ===
                   D. bipectinata  ===
                        D_obscura  ===
                     D_subobscura  ===
                          D_hydei  ===
B D                  D. persimilis  ===
               Teleopsis_dalmanni  ===
               Zaprionus_indianus  ===
    Scaptodrosophila_lebanonensis  ===
                     T. castaneum  ===
                        D_serrata  ===
                        D_montana  ===

Inserts between block 31 and 32 in window
                     D. biarmipes 19bp
                       D. suzukii 19bp
                    D. takahashii 276bp

Alignment block 32 of 1353 in window, 826766 - 826769, 4 bps 
B D                D. melanogaster  tata--
  D                    D. simulans  tata--
B D                   D. sechellia  tata--
                         D. erecta  aatg--
                         D. yakuba  agtg--
                     D. ficusphila  aatg--
                     D. eugracilis  c-tg--
                      D. biarmipes  ccta--
                        D. suzukii  ccta--
                        D. elegans  --aa--
                       D. rhopaloa  --ta--
                      D. ananassae  ggca--
                    D. bipectinata  ggca--
                       D_americana  --cata
                    D_novamexicana  --cata
                        D. virilis  --tata
                          D_nasuta  --tgtg
                     D. albomicans  --tgtg
                    D. willistoni  ======
                     D. grimshawi  ======
                       D. miranda  ------
                      D_athabasca  ------
                 D. pseudoobscura  ------
                       D_arizonae  ======
                    D. mojavensis  ======
        Proctacanthus_coquilletti  ======
                Bactrocera_tryoni  ======
               Belgica_antarctica  ======
            Culicoides_sonorensis  ======
                     A. mellifera  ======
            Lutzomyia_longipalpis  ======
               Chironomus_tentans  ======
                        A_farauti  ======
              Stomoxys_calcitrans  ======
                 Bactrocera_oleae  ======
               Ceratitis_capitata  ======
                  Lucilia_cuprina  ======
             Bactrocera_latifrons  ======
              Bactrocera_dorsalis  ======
            Zeugodacus_cucurbitae  ======
                     M. domestica  ======
                    D. takahashii  ======
                      D. kikkawai  ======
                D_pseudoobscura_1  ------
                        D_obscura  ======
                     D_subobscura  ======
                          D_hydei  ======
B D                  D. persimilis  ======
               Teleopsis_dalmanni  ======
               Zaprionus_indianus  ======
    Scaptodrosophila_lebanonensis  ======
                     T. castaneum  ======
                        D_serrata  ======
                        D_montana  ======

Inserts between block 32 and 33 in window
                     D. biarmipes 2bp
                       D. suzukii 2bp
                       D. elegans 3bp
                      D. rhopaloa 3bp

Alignment block 33 of 1353 in window, 826770 - 826773, 4 bps 
B D                D. melanogaster  tatg
  D                    D. simulans  tatg
B D                   D. sechellia  tatg
                         D. erecta  ccag
                         D. yakuba  ccag
                     D. ficusphila  ccag
                     D. eugracilis  ctaa
                      D. biarmipes  aggg
                        D. suzukii  aagg
                     D. takahashii  tttg
                        D. elegans  ctag
                       D. rhopaloa  ctag
                      D. ananassae  cttg
                    D. bipectinata  ctcg
                       D_americana  tatg
                    D_novamexicana  tatg
                        D. virilis  tatg
                       D_athabasca  ---g
                  D. pseudoobscura  ---g
                          D_nasuta  tttg
                     D. albomicans  tgtg
                    D. willistoni  ====
                     D. grimshawi  ====
                       D. miranda  ----
                       D_arizonae  ====
                    D. mojavensis  ====
        Proctacanthus_coquilletti  ====
                Bactrocera_tryoni  ====
               Belgica_antarctica  ====
            Culicoides_sonorensis  ====
                     A. mellifera  ====
            Lutzomyia_longipalpis  ====
               Chironomus_tentans  ====
                        A_farauti  ====
              Stomoxys_calcitrans  ====
                 Bactrocera_oleae  ====
               Ceratitis_capitata  ====
                  Lucilia_cuprina  ====
             Bactrocera_latifrons  ====
              Bactrocera_dorsalis  ====
            Zeugodacus_cucurbitae  ====
                     M. domestica  ====
                      D. kikkawai  ====
                D_pseudoobscura_1  ----
                        D_obscura  ====
                     D_subobscura  ====
                          D_hydei  ====
B D                  D. persimilis  ====
               Teleopsis_dalmanni  ====
               Zaprionus_indianus  ====
    Scaptodrosophila_lebanonensis  ====
                     T. castaneum  ====
                        D_serrata  ====
                        D_montana  ====

Inserts between block 33 and 34 in window
                     D. ananassae 5bp
                   D. bipectinata 1bp

Alignment block 34 of 1353 in window, 826774 - 826776, 3 bps 
B D                D. melanogaster  tgt
  D                    D. simulans  tat
B D                   D. sechellia  tat
                         D. erecta  tgt
                         D. yakuba  tgt
                     D. ficusphila  tgt
                     D. eugracilis  ttc
                      D. biarmipes  t--
                        D. suzukii  t--
                     D. takahashii  t--
                        D. elegans  t--
                       D. rhopaloa  t--
                      D. ananassae  t--
                       D_americana  tgt
                    D_novamexicana  tgt
                        D. virilis  tgt
                       D_athabasca  tgc
                  D. pseudoobscura  tgc
                          D_nasuta  tgt
                     D. albomicans  tgt
                    D. willistoni  ===
                     D. grimshawi  ===
                       D. miranda  ---
                       D_arizonae  ===
                    D. mojavensis  ===
        Proctacanthus_coquilletti  ===
                Bactrocera_tryoni  ===
               Belgica_antarctica  ===
            Culicoides_sonorensis  ===
                     A. mellifera  ===
            Lutzomyia_longipalpis  ===
               Chironomus_tentans  ===
                        A_farauti  ===
              Stomoxys_calcitrans  ===
                 Bactrocera_oleae  ===
               Ceratitis_capitata  ===
                  Lucilia_cuprina  ===
             Bactrocera_latifrons  ===
              Bactrocera_dorsalis  ===
            Zeugodacus_cucurbitae  ===
                     M. domestica  ===
                      D. kikkawai  ===
                   D. bipectinata  ===
                D_pseudoobscura_1  ---
                        D_obscura  ===
                     D_subobscura  ===
                          D_hydei  ===
B D                  D. persimilis  ===
               Teleopsis_dalmanni  ===
               Zaprionus_indianus  ===
    Scaptodrosophila_lebanonensis  ===
                     T. castaneum  ===
                        D_serrata  ===
                        D_montana  ===

Inserts between block 34 and 35 in window
                     D. biarmipes 3bp
                       D. suzukii 143bp

Alignment block 35 of 1353 in window, 826777 - 826778, 2 bps 
B D                D. melanogaster  g---------------------------------t
  D                    D. simulans  g----------------------------------
B D                   D. sechellia  g----------------------------------
                         D. erecta  tgcagagctcccaaa-----ttgcagagc-----t
                         D. yakuba  tgcagagctcctagc-------------------a
                     D. ficusphila  tgtggagtcgataaa-----atcttgtac---cta
                     D. eugracilis  tgcatcgtaccaggaggtacatgtagatataaccg
                       D_americana  ------gt---------------------------
                    D_novamexicana  ------gt---------------------------
                        D. virilis  ------gt---------------------------
                       D_athabasca  ------gt---------------------------
                 D_pseudoobscura_1  ------gc---------------------------
                        D. miranda  ------gc---------------------------
                  D. pseudoobscura  ------gt---------------------------
                          D_nasuta  ------gt---------------------------
                     D. albomicans  ------gt---------------------------
                    D. willistoni  ===================================
                     D. grimshawi  ===================================
                     D. ananassae  -----------------------------------
                     D. biarmipes  ===================================
                       D_arizonae  ===================================
                    D. mojavensis  ===================================
        Proctacanthus_coquilletti  ===================================
                Bactrocera_tryoni  ===================================
               Belgica_antarctica  ===================================
            Culicoides_sonorensis  ===================================
                     A. mellifera  ===================================
            Lutzomyia_longipalpis  ===================================
               Chironomus_tentans  ===================================
                        A_farauti  ===================================
              Stomoxys_calcitrans  ===================================
                 Bactrocera_oleae  ===================================
               Ceratitis_capitata  ===================================
                  Lucilia_cuprina  ===================================
             Bactrocera_latifrons  ===================================
              Bactrocera_dorsalis  ===================================
            Zeugodacus_cucurbitae  ===================================
                     M. domestica  ===================================
                      D. rhopaloa  -----------------------------------
                    D. takahashii  -----------------------------------
                      D. kikkawai  ===================================
                   D. bipectinata  ===================================
                        D_obscura  ===================================
                     D_subobscura  ===================================
                          D_hydei  ===================================
B D                  D. persimilis  ===================================
                       D. elegans  -----------------------------------
               Teleopsis_dalmanni  ===================================
               Zaprionus_indianus  ===================================
    Scaptodrosophila_lebanonensis  ===================================
                     T. castaneum  ===================================
                        D_serrata  ===================================
                        D_montana  ===================================
                       D. suzukii  ===================================

Inserts between block 35 and 36 in window
                      D_americana 5981bp
                   D_novamexicana 5887bp
                       D. virilis 4413bp

Alignment block 36 of 1353 in window, 826779 - 826783, 5 bps 
B D                D. melanogaster  acata
  D                    D. simulans  ---aa
B D                   D. sechellia  ---aa
                         D. erecta  aaata
                         D. yakuba  aaaga
                     D. ficusphila  aggaa
                     D. eugracilis  tagat
                        D. elegans  ----g
                       D. rhopaloa  ----g
                       D_athabasca  acgca
                 D_pseudoobscura_1  acaca
                        D. miranda  acaca
                  D. pseudoobscura  acgca
                         D_obscura  gtgcg
                          D_nasuta  aggtg
                     D. albomicans  gtgta
                    D. willistoni  =====
                     D. grimshawi  =====
                     D. ananassae  -----
                     D. biarmipes  =====
                       D_arizonae  =====
                    D. mojavensis  =====
                       D. virilis  =====
                   D_novamexicana  =====
        Proctacanthus_coquilletti  =====
                Bactrocera_tryoni  =====
               Belgica_antarctica  =====
            Culicoides_sonorensis  =====
                     A. mellifera  =====
            Lutzomyia_longipalpis  =====
               Chironomus_tentans  =====
                        A_farauti  =====
              Stomoxys_calcitrans  =====
                 Bactrocera_oleae  =====
               Ceratitis_capitata  =====
                  Lucilia_cuprina  =====
             Bactrocera_latifrons  =====
              Bactrocera_dorsalis  =====
            Zeugodacus_cucurbitae  =====
                      D_americana  =====
                     M. domestica  =====
                    D. takahashii  -----
                      D. kikkawai  =====
                   D. bipectinata  =====
                     D_subobscura  =====
                          D_hydei  =====
B D                  D. persimilis  =====
               Teleopsis_dalmanni  =====
               Zaprionus_indianus  =====
    Scaptodrosophila_lebanonensis  =====
                     T. castaneum  =====
                        D_serrata  =====
                        D_montana  =====
                       D. suzukii  =====

Inserts between block 36 and 37 in window
                         D_nasuta 14bp
                    D. albomicans 121bp

Alignment block 37 of 1353 in window, 826784 - 826794, 11 bps 
B D                D. melanogaster  ----------t------gtaccc--tttc
  D                    D. simulans  ----------t------gtacca--tttc
B D                   D. sechellia  ----------t------gcacca--tttc
                         D. erecta  ----------a------gtacct--tttt
                         D. yakuba  ----------t------gtacc---tttt
                     D. ficusphila  ----------a------gcacctggttct
                     D. eugracilis  ----------t------gcactt--ctaa
                      D. biarmipes  -----------------gtacct--gcga
                        D. suzukii  -----------------atacac--atgt
                     D. takahashii  -----------------gtacct--agat
                        D. elegans  ----------ttctgaagtacct--ttac
                       D. rhopaloa  ----------ttgcggagtacct--atac
                      D. ananassae  --------------gaaataatc--ctgc
                       D_athabasca  tttacc----g------ctgctc--tc--
                 D_pseudoobscura_1  gctaact-gtg------ccactt--tc--
                        D. miranda  gctaact-gtg------ccactt--tc--
                  D. pseudoobscura  tttacc----g------ctgctc--tc--
                         D_obscura  ttttcccaatg------acactt--tt--
                          D_nasuta  -------tctg------ctgttc--tc--
                    D. willistoni  =============================
                     D. grimshawi  =============================
                       D_arizonae  =============================
                    D. mojavensis  =============================
                       D. virilis  =============================
                   D_novamexicana  =============================
                    D. albomicans  =============================
        Proctacanthus_coquilletti  =============================
                Bactrocera_tryoni  =============================
               Belgica_antarctica  =============================
            Culicoides_sonorensis  =============================
                     A. mellifera  =============================
            Lutzomyia_longipalpis  =============================
               Chironomus_tentans  =============================
                        A_farauti  =============================
              Stomoxys_calcitrans  =============================
                 Bactrocera_oleae  =============================
               Ceratitis_capitata  =============================
                  Lucilia_cuprina  =============================
             Bactrocera_latifrons  =============================
              Bactrocera_dorsalis  =============================
            Zeugodacus_cucurbitae  =============================
                      D_americana  =============================
                     M. domestica  =============================
                      D. kikkawai  =============================
                   D. bipectinata  =============================
                     D_subobscura  =============================
                          D_hydei  =============================
B D                  D. persimilis  =============================
               Teleopsis_dalmanni  =============================
               Zaprionus_indianus  =============================
    Scaptodrosophila_lebanonensis  =============================
                     T. castaneum  =============================
                        D_serrata  =============================
                        D_montana  =============================

Inserts between block 37 and 38 in window
                     D. biarmipes 38bp
                       D. suzukii 30bp
                    D. takahashii 24bp
                       D. elegans 272bp
                      D. rhopaloa 32bp
                     D. ananassae 5bp

Alignment block 38 of 1353 in window, 826795 - 826799, 5 bps 
B D                D. melanogaster  ccttg
  D                    D. simulans  ccttg
B D                   D. sechellia  ccttg
                         D. erecta  ccttg
                         D. yakuba  ccttg
                     D. ficusphila  ttttg
                     D. eugracilis  ccttc
                      D. biarmipes  tttta
                     D. takahashii  -ctta
                       D. rhopaloa  ccttg
                      D. ananassae  cgcta
                       D_athabasca  ccttg
                 D_pseudoobscura_1  ccctc
                        D. miranda  ccctc
                  D. pseudoobscura  cctcg
                         D_obscura  tcttt
                          D_nasuta  tttg-
                    D. willistoni  =====
                     D. grimshawi  =====
                       D_arizonae  =====
                    D. mojavensis  =====
                       D. virilis  =====
                   D_novamexicana  =====
                    D. albomicans  =====
        Proctacanthus_coquilletti  =====
                Bactrocera_tryoni  =====
               Belgica_antarctica  =====
            Culicoides_sonorensis  =====
                     A. mellifera  =====
            Lutzomyia_longipalpis  =====
               Chironomus_tentans  =====
                        A_farauti  =====
              Stomoxys_calcitrans  =====
                 Bactrocera_oleae  =====
               Ceratitis_capitata  =====
                  Lucilia_cuprina  =====
             Bactrocera_latifrons  =====
              Bactrocera_dorsalis  =====
            Zeugodacus_cucurbitae  =====
                      D_americana  =====
                     M. domestica  =====
                      D. kikkawai  =====
                   D. bipectinata  =====
                     D_subobscura  =====
                          D_hydei  =====
B D                  D. persimilis  =====
                       D. elegans  =====
               Teleopsis_dalmanni  =====
               Zaprionus_indianus  =====
    Scaptodrosophila_lebanonensis  =====
                     T. castaneum  =====
                        D_serrata  =====
                        D_montana  =====
                       D. suzukii  =====

Inserts between block 38 and 39 in window
                     D. biarmipes 4bp
                    D. takahashii 6bp
                      D. rhopaloa 62bp
                       D. miranda 1bp
                 D. pseudoobscura 993bp

Alignment block 39 of 1353 in window, 826800 - 826801, 2 bps 
B D                D. melanogaster  -tc
  D                    D. simulans  -tc
B D                   D. sechellia  -tc
                         D. erecta  -tc
                         D. yakuba  -tc
                     D. ficusphila  -tc
                     D. eugracilis  -ca
                      D. ananassae  -tc
                       D_athabasca  gt-
                        D. miranda  -c-
                         D_obscura  -t-
                          D_nasuta  -c-
                    D. willistoni  ===
                     D. grimshawi  ===
                 D. pseudoobscura  ===
                     D. biarmipes  ===
                       D_arizonae  ===
                    D. mojavensis  ===
                       D. virilis  ===
                   D_novamexicana  ===
                    D. albomicans  ===
        Proctacanthus_coquilletti  ===
                Bactrocera_tryoni  ===
               Belgica_antarctica  ===
            Culicoides_sonorensis  ===
                     A. mellifera  ===
            Lutzomyia_longipalpis  ===
               Chironomus_tentans  ===
                        A_farauti  ===
              Stomoxys_calcitrans  ===
                 Bactrocera_oleae  ===
               Ceratitis_capitata  ===
                  Lucilia_cuprina  ===
             Bactrocera_latifrons  ===
              Bactrocera_dorsalis  ===
            Zeugodacus_cucurbitae  ===
                      D_americana  ===
                     M. domestica  ===
                      D. rhopaloa  ===
                    D. takahashii  ===
                      D. kikkawai  ===
                   D. bipectinata  ===
                D_pseudoobscura_1  ---
                     D_subobscura  ===
                          D_hydei  ===
B D                  D. persimilis  ===
                       D. elegans  ===
               Teleopsis_dalmanni  ===
               Zaprionus_indianus  ===
    Scaptodrosophila_lebanonensis  ===
                     T. castaneum  ===
                        D_serrata  ===
                        D_montana  ===
                       D. suzukii  ===

Inserts between block 39 and 40 in window
                      D_athabasca 104bp
                       D. miranda 1bp
                        D_obscura 1bp
                         D_nasuta 1bp

Alignment block 40 of 1353 in window, 826802 - 826803, 2 bps 
B D                D. melanogaster  ta
  D                    D. simulans  ca
B D                   D. sechellia  ta
                         D. erecta  ca
                         D. yakuba  ta
                     D. ficusphila  tc
                     D. eugracilis  cc
                      D. ananassae  ga
                    D. willistoni  ==
                     D. grimshawi  ==
                       D. miranda  ==
                      D_athabasca  ==
                 D. pseudoobscura  ==
                     D. biarmipes  ==
                       D_arizonae  ==
                    D. mojavensis  ==
                       D. virilis  ==
                   D_novamexicana  ==
                    D. albomicans  ==
                         D_nasuta  ==
        Proctacanthus_coquilletti  ==
                Bactrocera_tryoni  ==
               Belgica_antarctica  ==
            Culicoides_sonorensis  ==
                     A. mellifera  ==
            Lutzomyia_longipalpis  ==
               Chironomus_tentans  ==
                        A_farauti  ==
              Stomoxys_calcitrans  ==
                 Bactrocera_oleae  ==
               Ceratitis_capitata  ==
                  Lucilia_cuprina  ==
             Bactrocera_latifrons  ==
              Bactrocera_dorsalis  ==
            Zeugodacus_cucurbitae  ==
                      D_americana  ==
                     M. domestica  ==
                      D. rhopaloa  ==
                    D. takahashii  ==
                      D. kikkawai  ==
                   D. bipectinata  ==
                D_pseudoobscura_1  --
                        D_obscura  ==
                     D_subobscura  ==
                          D_hydei  ==
B D                  D. persimilis  ==
                       D. elegans  ==
               Teleopsis_dalmanni  ==
               Zaprionus_indianus  ==
    Scaptodrosophila_lebanonensis  ==
                     T. castaneum  ==
                        D_serrata  ==
                        D_montana  ==
                       D. suzukii  ==

Alignment block 41 of 1353 in window, 826804 - 826807, 4 bps 
B D                D. melanogaster  gata
  D                    D. simulans  gatg
B D                   D. sechellia  gatg
                         D. erecta  gatg
                         D. yakuba  gatg
                     D. ficusphila  gatg
                     D. eugracilis  atta
                      D. biarmipes  gcta
                     D. takahashii  actt
                        D. elegans  gatt
                       D. rhopaloa  aatt
                      D. ananassae  gcca
                          D_nasuta  -ctg
                    D. willistoni  ====
                     D. grimshawi  ====
                       D. miranda  ====
                      D_athabasca  ====
                 D. pseudoobscura  ====
                       D_arizonae  ====
                    D. mojavensis  ====
                       D. virilis  ====
                   D_novamexicana  ====
                    D. albomicans  ====
        Proctacanthus_coquilletti  ====
                Bactrocera_tryoni  ====
               Belgica_antarctica  ====
            Culicoides_sonorensis  ====
                     A. mellifera  ====
            Lutzomyia_longipalpis  ====
               Chironomus_tentans  ====
                        A_farauti  ====
              Stomoxys_calcitrans  ====
                 Bactrocera_oleae  ====
               Ceratitis_capitata  ====
                  Lucilia_cuprina  ====
             Bactrocera_latifrons  ====
              Bactrocera_dorsalis  ====
            Zeugodacus_cucurbitae  ====
                      D_americana  ====
                     M. domestica  ====
                      D. kikkawai  ====
                   D. bipectinata  ====
                D_pseudoobscura_1  ----
                        D_obscura  ====
                     D_subobscura  ====
                          D_hydei  ====
B D                  D. persimilis  ====
               Teleopsis_dalmanni  ====
               Zaprionus_indianus  ====
    Scaptodrosophila_lebanonensis  ====
                     T. castaneum  ====
                        D_serrata  ====
                        D_montana  ====
                       D. suzukii  ====

Inserts between block 41 and 42 in window
                     D. ananassae 43bp

Alignment block 42 of 1353 in window, 826808 - 826890, 83 bps 
B D                D. melanogaster  gat-----------------------g-----aaaca--------------------------------g
  D                    D. simulans  gat-----------------------g-----taaca--------------------------------g
B D                   D. sechellia  gat-----------------------g-----taaca--------------------------------g
                         D. erecta  ggttggattcgtcttgaatgaacatgg-----aaata--------------------------------g
                         D. yakuba  gta-ggattcgtcttgaatgaaccaag-----aaatt--------------------------------g
                     D. ficusphila  ata---------------------------------g--------------------------------g
                     D. eugracilis  tag-----------------------a-----gttca--------------------------------t
                      D. biarmipes  aaa-----------------------a-----tgatcctgtggacccagaagtcccctttacttaccact
                        D. suzukii  gaa-----------------------a-----tgatactcaagttctatga------------------t
                     D. takahashii  gaa-----------------------a-----tgag---------------------------------t
                        D. elegans  gac-----------------------a-----caata--------------------------------t
                       D. rhopaloa  aag-----------------------aagtaccaatatact----------------------------t
                 D_pseudoobscura_1  ----------------------------------------------------------------------
                        D. miranda  ----------------------------------------------------------------------
                         D_obscura  ----------------------------------------------------------------------
                          D_nasuta  ----------------------------------------------------------------------
                    D. willistoni  ======================================================================
                     D. grimshawi  ======================================================================
                     D. ananassae  ======================================================================
                      D_athabasca  ======================================================================
                 D. pseudoobscura  ======================================================================
                       D_arizonae  ======================================================================
                    D. mojavensis  ======================================================================
                       D. virilis  ======================================================================
                   D_novamexicana  ======================================================================
                    D. albomicans  ======================================================================
        Proctacanthus_coquilletti  ======================================================================
                Bactrocera_tryoni  ======================================================================
               Belgica_antarctica  ======================================================================
            Culicoides_sonorensis  ======================================================================
                     A. mellifera  ======================================================================
            Lutzomyia_longipalpis  ======================================================================
               Chironomus_tentans  ======================================================================
                        A_farauti  ======================================================================
              Stomoxys_calcitrans  ======================================================================
                 Bactrocera_oleae  ======================================================================
               Ceratitis_capitata  ======================================================================
                  Lucilia_cuprina  ======================================================================
             Bactrocera_latifrons  ======================================================================
              Bactrocera_dorsalis  ======================================================================
            Zeugodacus_cucurbitae  ======================================================================
                      D_americana  ======================================================================
                     M. domestica  ======================================================================
                      D. kikkawai  ======================================================================
                   D. bipectinata  ======================================================================
                     D_subobscura  ======================================================================
                          D_hydei  ======================================================================
B D                  D. persimilis  ======================================================================
               Teleopsis_dalmanni  ======================================================================
               Zaprionus_indianus  ======================================================================
    Scaptodrosophila_lebanonensis  ======================================================================
                     T. castaneum  ======================================================================
                        D_serrata  ======================================================================
                        D_montana  ======================================================================

                   D. melanogaster  ataaatcgtgaagatg-cttcacttacca---------------------taaatctat--a--------
                       D. simulans  ataaatcgcgaagatg-cttcacttacca---------------------tatatctataaa--------
                      D. sechellia  ataaatcgcgaagatg-cttcacttacca---------------------tagatctataaa--------
                         D. erecta  attaaacataaaaatgtcgttaaatatgagtagttt---------gtagttagatctaa--a--------
                         D. yakuba  attaaatacaaacaagtctttaaatattaatagtttggctt-accgtaaatagatttaa--a--------
                     D. ficusphila  ttctatcatacatacg--ctcagttagtc---------------------ttcacctaa-----------
                     D. eugracilis  ctctatctaaaaacaa-cttttctcacct--------------------tcttatttgg--g--------
                      D. biarmipes  ataatttgcaaaatta-------atataaatatgtct------gtgaacttccttttaa--t--------
                        D. suzukii  ataatttgaataccta----gctatgtcaatagctcg------ttttaccttactagga--t--------
                     D. takahashii  ata---tgagca-----------atatcaa------------------------tttga--t--------
                        D. elegans  ttaaattgattga--a--ttggcaca-----------------attgattttcatttaa--t--------
                       D. rhopaloa  ttgagttgattggcta--ttgtttcaacaaaaacttct-----atcaatgtatgtataa--t--------
                 D_pseudoobscura_1  --------------------------------------------ccctcccctccccac--a--------
                        D. miranda  ------------------------------------------tcccctcccctccccac--a--------
                         D_obscura  -----------------------tgggtaacgtaacccatggttcgtgcccctttctgc--a--------
                          D_nasuta  --------------------ctttggccatcttcatctttcactttctctccctctcgc--gatgggtgt
                     D. willistoni  ======================================================================
                      D. grimshawi  ======================================================================
                      D. ananassae  ======================================================================
                       D_athabasca  ======================================================================
                  D. pseudoobscura  ======================================================================
                        D_arizonae  ======================================================================
                     D. mojavensis  ======================================================================
                        D. virilis  ======================================================================
                    D_novamexicana  ======================================================================
                     D. albomicans  ======================================================================
         Proctacanthus_coquilletti  ======================================================================
                 Bactrocera_tryoni  ======================================================================
                Belgica_antarctica  ======================================================================
             Culicoides_sonorensis  ======================================================================
                      A. mellifera  ======================================================================
             Lutzomyia_longipalpis  ======================================================================
                Chironomus_tentans  ======================================================================
                         A_farauti  ======================================================================
               Stomoxys_calcitrans  ======================================================================
                  Bactrocera_oleae  ======================================================================
                Ceratitis_capitata  ======================================================================
                   Lucilia_cuprina  ======================================================================
              Bactrocera_latifrons  ======================================================================
               Bactrocera_dorsalis  ======================================================================
             Zeugodacus_cucurbitae  ======================================================================
                       D_americana  ======================================================================
                      M. domestica  ======================================================================
                       D. kikkawai  ======================================================================
                    D. bipectinata  ======================================================================
                      D_subobscura  ======================================================================
                           D_hydei  ======================================================================
                     D. persimilis  ======================================================================
                Teleopsis_dalmanni  ======================================================================
                Zaprionus_indianus  ======================================================================
     Scaptodrosophila_lebanonensis  ======================================================================
                      T. castaneum  ======================================================================
                         D_serrata  ======================================================================
                         D_montana  ======================================================================

                   D. melanogaster  ---atatgtt------------------cat------tgctcaaata----ct------actata-----
                       D. simulans  ---atatgtt------------------cct------tgcccaaa-------------------------
                      D. sechellia  ---atatgtt------------------cct------tgctccaata----ct------aatata-----
                         D. erecta  ---attaggg------------------cgt------tactcaaata----cc------tctata-----
                         D. yakuba  ---atcaggt------------------tgt------tactcaaaga----at------actaca-----
                     D. ficusphila  ----------------------------cat------tattcagata----ttcga---acgaag-----
                     D. eugracilis  ---ataggttatcagattctttggaaaaagt------tattcaaatt----tt------attcat-----
                      D. biarmipes  ---atgatag------------------caa-agttctgacaaaaaa----ttagtgtaccaggac----
                        D. suzukii  ---ctgggga---------------------------tgaccaaaat----aaaatgc-ccattac----
                     D. takahashii  ---a---------------------------------tgcctacatt----a-------tctctac----
                        D. elegans  ---cctagtc------------------tat-ggttctgaaaaaatc----ttaaaa--tttttac----
                       D. rhopaloa  ---cttaacc------------------tctagattctagaaaaatg----gtatga--attgcacctta
                 D_pseudoobscura_1  ---gcaccac------------------cac------caccacaaca-----------------------
                        D. miranda  ---gcaccac------------------cac------caccacaaca-----------------------
                         D_obscura  ---atcctgc------------------aac------ga-------------------------------
                          D_nasuta  tgtgcattgc------------------aac------ccccaaaacgcgca-------------------
                     D. willistoni  ======================================================================
                      D. grimshawi  ======================================================================
                      D. ananassae  ======================================================================
                       D_athabasca  ======================================================================
                  D. pseudoobscura  ======================================================================
                        D_arizonae  ======================================================================
                     D. mojavensis  ======================================================================
                        D. virilis  ======================================================================
                    D_novamexicana  ======================================================================
                     D. albomicans  ======================================================================
         Proctacanthus_coquilletti  ======================================================================
                 Bactrocera_tryoni  ======================================================================
                Belgica_antarctica  ======================================================================
             Culicoides_sonorensis  ======================================================================
                      A. mellifera  ======================================================================
             Lutzomyia_longipalpis  ======================================================================
                Chironomus_tentans  ======================================================================
                         A_farauti  ======================================================================
               Stomoxys_calcitrans  ======================================================================
                  Bactrocera_oleae  ======================================================================
                Ceratitis_capitata  ======================================================================
                   Lucilia_cuprina  ======================================================================
              Bactrocera_latifrons  ======================================================================
               Bactrocera_dorsalis  ======================================================================
             Zeugodacus_cucurbitae  ======================================================================
                       D_americana  ======================================================================
                      M. domestica  ======================================================================
                       D. kikkawai  ======================================================================
                    D. bipectinata  ======================================================================
                      D_subobscura  ======================================================================
                           D_hydei  ======================================================================
                     D. persimilis  ======================================================================
                Teleopsis_dalmanni  ======================================================================
                Zaprionus_indianus  ======================================================================
     Scaptodrosophila_lebanonensis  ======================================================================
                      T. castaneum  ======================================================================
                         D_serrata  ======================================================================
                         D_montana  ======================================================================

                   D. melanogaster  gtag---------------------------------------gta
                       D. simulans  ----------------------------------------------
                      D. sechellia  gtag---------------------------------------g--
                         D. erecta  atag---------------------------------------gta
                         D. yakuba  atag---------------------------------------gta
                     D. ficusphila  ggag---------------------------------------gaa
                     D. eugracilis  ttac---------------------------------------ctt
                      D. biarmipes  ctagggataacaaaaatatctctttgaaatgctcattactggagta
                        D. suzukii  ctag---------------------------------------gta
                     D. takahashii  tcag---------------------------------------gta
                        D. elegans  ccat---------------------------------------gta
                       D. rhopaloa  ccag---------------------------------------gta
                 D_pseudoobscura_1  ----------------------------------------------
                        D. miranda  ----------------------------------------------
                         D_obscura  ----------------------------------------------
                          D_nasuta  ----------------------------------------------
                     D. willistoni  ==============================================
                      D. grimshawi  ==============================================
                      D. ananassae  ==============================================
                       D_athabasca  ==============================================
                  D. pseudoobscura  ==============================================
                        D_arizonae  ==============================================
                     D. mojavensis  ==============================================
                        D. virilis  ==============================================
                    D_novamexicana  ==============================================
                     D. albomicans  ==============================================
         Proctacanthus_coquilletti  ==============================================
                 Bactrocera_tryoni  ==============================================
                Belgica_antarctica  ==============================================
             Culicoides_sonorensis  ==============================================
                      A. mellifera  ==============================================
             Lutzomyia_longipalpis  ==============================================
                Chironomus_tentans  ==============================================
                         A_farauti  ==============================================
               Stomoxys_calcitrans  ==============================================
                  Bactrocera_oleae  ==============================================
                Ceratitis_capitata  ==============================================
                   Lucilia_cuprina  ==============================================
              Bactrocera_latifrons  ==============================================
               Bactrocera_dorsalis  ==============================================
             Zeugodacus_cucurbitae  ==============================================
                       D_americana  ==============================================
                      M. domestica  ==============================================
                       D. kikkawai  ==============================================
                    D. bipectinata  ==============================================
                      D_subobscura  ==============================================
                           D_hydei  ==============================================
                     D. persimilis  ==============================================
                Teleopsis_dalmanni  ==============================================
                Zaprionus_indianus  ==============================================
     Scaptodrosophila_lebanonensis  ==============================================
                      T. castaneum  ==============================================
                         D_serrata  ==============================================
                         D_montana  ==============================================

Inserts between block 42 and 43 in window
                        D_obscura 18bp

Alignment block 43 of 1353 in window, 826891 - 826906, 16 bps 
B D                D. melanogaster  cttgtgt----ttttcaaaa
  D                    D. simulans  -------------------a
B D                   D. sechellia  -----------tcgaaaata
                         D. erecta  cttgtat----ttttcaaaa
                         D. yakuba  cttgtgt--accttgtgtaa
                     D. ficusphila  tttagac-aacttttggata
                     D. eugracilis  gttatta-gttttggcaagt
                      D. biarmipes  cctactt----tagcg-aga
                        D. suzukii  ccttttt----ctgcc-aaa
                     D. takahashii  cttcttt----ttgccaaaa
                        D. elegans  cttgc---------------
                       D. rhopaloa  tttgttt----ttgca-aaa
                       D_athabasca  ctcgtgcc------------
                          D_nasuta  ctctttc-------------
                    D. willistoni  ====================
                     D. grimshawi  ====================
                     D. ananassae  ====================
                       D. miranda  --------------------
                 D. pseudoobscura  ====================
                       D_arizonae  ====================
                    D. mojavensis  ====================
                       D. virilis  ====================
                   D_novamexicana  ====================
                    D. albomicans  ====================
        Proctacanthus_coquilletti  ====================
                Bactrocera_tryoni  ====================
               Belgica_antarctica  ====================
            Culicoides_sonorensis  ====================
                     A. mellifera  ====================
            Lutzomyia_longipalpis  ====================
               Chironomus_tentans  ====================
                        A_farauti  ====================
              Stomoxys_calcitrans  ====================
                 Bactrocera_oleae  ====================
               Ceratitis_capitata  ====================
                  Lucilia_cuprina  ====================
             Bactrocera_latifrons  ====================
              Bactrocera_dorsalis  ====================
            Zeugodacus_cucurbitae  ====================
                      D_americana  ====================
                     M. domestica  ====================
                      D. kikkawai  ====================
                   D. bipectinata  ====================
                D_pseudoobscura_1  --------------------
                        D_obscura  ====================
                     D_subobscura  ====================
                          D_hydei  ====================
B D                  D. persimilis  ====================
               Teleopsis_dalmanni  ====================
               Zaprionus_indianus  ====================
    Scaptodrosophila_lebanonensis  ====================
                     T. castaneum  ====================
                        D_serrata  ====================
                        D_montana  ====================

Alignment block 44 of 1353 in window, 826907 - 826908, 2 bps 
B D                D. melanogaster  g------c
  D                    D. simulans  g------c
B D                   D. sechellia  a------c
                         D. erecta  g------c
                         D. yakuba  g------c
                     D. ficusphila  gattagcc
                     D. eugracilis  a------c
                      D. biarmipes  g------c
                        D. suzukii  t------c
                     D. takahashii  a------c
                        D. elegans  a------c
                       D. rhopaloa  a------c
                       D_athabasca  -------c
                 D_pseudoobscura_1  -------c
                        D. miranda  -------c
                          D_nasuta  g------c
                     D. albomicans  g------c
                    D. willistoni  ========
                     D. grimshawi  ========
                     D. ananassae  ========
                 D. pseudoobscura  ========
                       D_arizonae  ========
                    D. mojavensis  ========
                       D. virilis  ========
                   D_novamexicana  ========
        Proctacanthus_coquilletti  ========
                Bactrocera_tryoni  ========
               Belgica_antarctica  ========
            Culicoides_sonorensis  ========
                     A. mellifera  ========
            Lutzomyia_longipalpis  ========
               Chironomus_tentans  ========
                        A_farauti  ========
              Stomoxys_calcitrans  ========
                 Bactrocera_oleae  ========
               Ceratitis_capitata  ========
                  Lucilia_cuprina  ========
             Bactrocera_latifrons  ========
              Bactrocera_dorsalis  ========
            Zeugodacus_cucurbitae  ========
                      D_americana  ========
                     M. domestica  ========
                      D. kikkawai  ========
                   D. bipectinata  ========
                        D_obscura  ========
                     D_subobscura  ========
                          D_hydei  ========
B D                  D. persimilis  ========
               Teleopsis_dalmanni  ========
               Zaprionus_indianus  ========
    Scaptodrosophila_lebanonensis  ========
                     T. castaneum  ========
                        D_serrata  ========
                        D_montana  ========

Inserts between block 44 and 45 in window
                      D_athabasca 39bp
                D_pseudoobscura_1 8bp
                       D. miranda 8bp
                         D_nasuta 6bp
                    D. albomicans 6bp

Alignment block 45 of 1353 in window, 826909 - 826927, 19 bps 
B D                D. melanogaster  ctgt-gccaggtac-a-aa-agc
  D                    D. simulans  ctgt-cccaggtac-a-aa-agc
B D                   D. sechellia  ctgt-cccaggtac-a-aa-agc
                         D. erecta  ctat-cccaggtac-a-ag-agc
                         D. yakuba  ctat-ctgaggtac-a-aa-agc
                     D. ficusphila  ttgtacctggatacaa-aa-aga
                     D. eugracilis  cctg-cccaggtac-a-aatacc
                      D. biarmipes  ctct-cccaggtacca-ag-agc
                        D. suzukii  ctct-cccaggtacca-aa-cgc
                     D. takahashii  ctct-cccaggtaccc-ta-agc
                        D. elegans  acta-tttaggtacaacaa-gac
                       D. rhopaloa  aata-cctaggtacaa-----gc
                       D_athabasca  ctgt-gccacatt--c-gc-ctc
                 D_pseudoobscura_1  -----gccatatca-c-gc-ccc
                        D. miranda  -----gccatatca-c-gc-ccc
                      D_subobscura  ctgt-gccacattc-c-cc-acc
                         D_obscura  ctgt-gccacattc-c-ccaccc
                          D_nasuta  ttgg-tccatgctt-g-gg-ctt
                     D. albomicans  ttgg-tccatgctt-g-gg-ctt
                    D. willistoni  =======================
                     D. grimshawi  =======================
                     D. ananassae  =======================
                 D. pseudoobscura  =======================
                       D_arizonae  =======================
                    D. mojavensis  =======================
                       D. virilis  =======================
                   D_novamexicana  =======================
        Proctacanthus_coquilletti  =======================
                Bactrocera_tryoni  =======================
               Belgica_antarctica  =======================
            Culicoides_sonorensis  =======================
                     A. mellifera  =======================
            Lutzomyia_longipalpis  =======================
               Chironomus_tentans  =======================
                        A_farauti  =======================
              Stomoxys_calcitrans  =======================
                 Bactrocera_oleae  =======================
               Ceratitis_capitata  =======================
                  Lucilia_cuprina  =======================
             Bactrocera_latifrons  =======================
              Bactrocera_dorsalis  =======================
            Zeugodacus_cucurbitae  =======================
                      D_americana  =======================
                     M. domestica  =======================
                      D. kikkawai  =======================
                   D. bipectinata  =======================
                          D_hydei  =======================
B D                  D. persimilis  =======================
               Teleopsis_dalmanni  =======================
               Zaprionus_indianus  =======================
    Scaptodrosophila_lebanonensis  =======================
                     T. castaneum  =======================
                        D_serrata  =======================
                        D_montana  =======================

Alignment block 46 of 1353 in window, 826928 - 826943, 16 bps 
B D                D. melanogaster  ttgtactcttaacaac
  D                    D. simulans  ttgtactcttaacaac
B D                   D. sechellia  ttgtactcttaacaac
                         D. erecta  tggtactcttatcaac
                         D. yakuba  tggtactcttaccaac
                     D. ficusphila  gagtatatttctcaac
                     D. eugracilis  gagtattgatattaac
                      D. biarmipes  gagcactcctggcagc
                        D. suzukii  gagtactcttagcagc
                     D. takahashii  ccgtacttttaccaac
                        D. elegans  gcatagctttcccaac
                       D. rhopaloa  gcgtagctttcccaac
                       D. kikkawai  ttgcatttctggcatc
                       D_athabasca  ctctccccgcaacacc
                 D_pseudoobscura_1  gtccatccttggcaac
                        D. miranda  gtccatccttggcaac
                      D_subobscura  atcc--ccgcagcacc
                         D_obscura  atcc--cctcaacacc
                          D_nasuta  ttgtaactctgatt--
                     D. albomicans  ttgcaactctgatt--
                    D. willistoni  ================
                     D. grimshawi  ================
                     D. ananassae  ================
                 D. pseudoobscura  ================
                       D_arizonae  ================
                    D. mojavensis  ================
                       D. virilis  ================
                   D_novamexicana  ================
        Proctacanthus_coquilletti  ================
                Bactrocera_tryoni  ================
               Belgica_antarctica  ================
            Culicoides_sonorensis  ================
                     A. mellifera  ================
            Lutzomyia_longipalpis  ================
               Chironomus_tentans  ================
                        A_farauti  ================
              Stomoxys_calcitrans  ================
                 Bactrocera_oleae  ================
               Ceratitis_capitata  ================
                  Lucilia_cuprina  ================
             Bactrocera_latifrons  ================
              Bactrocera_dorsalis  ================
            Zeugodacus_cucurbitae  ================
                      D_americana  ================
                     M. domestica  ================
                   D. bipectinata  ================
                          D_hydei  ================
B D                  D. persimilis  ================
               Teleopsis_dalmanni  ================
               Zaprionus_indianus  ================
    Scaptodrosophila_lebanonensis  ================
                     T. castaneum  ================
                        D_serrata  ================
                        D_montana  ================

Inserts between block 46 and 47 in window
                         D_nasuta 19bp
                    D. albomicans 19bp

Alignment block 47 of 1353 in window, 826944 - 826950, 7 bps 
B D                D. melanogaster  actggga--------------------
  D                    D. simulans  actggga--------------------
B D                   D. sechellia  actggga--------------------
                         D. erecta  actggcc--------------------
                         D. yakuba  actggcc--------------------
                     D. ficusphila  actggac--------------------
                     D. eugracilis  actggcc--------------------
                      D. biarmipes  actgacc--------------------
                        D. suzukii  actgacc--------------------
                     D. takahashii  accgacc--------------------
                        D. elegans  actggcc--------------------
                       D. rhopaloa  actagcc--------------------
                       D. kikkawai  actccgc--------------------
                    D. bipectinata  attgtga--------------------
                       D_athabasca  ------acca-----------------
                 D_pseudoobscura_1  ------t--------------------
                        D. miranda  ------t--------------------
                      D_subobscura  ------a---tcaccaccaccacca--
                         D_obscura  ------a------------------gc
                    D. willistoni  ===========================
                     D. grimshawi  ===========================
                     D. ananassae  ===========================
                 D. pseudoobscura  ===========================
                       D_arizonae  ===========================
                    D. mojavensis  ===========================
                       D. virilis  ===========================
                   D_novamexicana  ===========================
                    D. albomicans  ===========================
                         D_nasuta  ===========================
        Proctacanthus_coquilletti  ===========================
                Bactrocera_tryoni  ===========================
               Belgica_antarctica  ===========================
            Culicoides_sonorensis  ===========================
                     A. mellifera  ===========================
            Lutzomyia_longipalpis  ===========================
               Chironomus_tentans  ===========================
                        A_farauti  ===========================
              Stomoxys_calcitrans  ===========================
                 Bactrocera_oleae  ===========================
               Ceratitis_capitata  ===========================
                  Lucilia_cuprina  ===========================
             Bactrocera_latifrons  ===========================
              Bactrocera_dorsalis  ===========================
            Zeugodacus_cucurbitae  ===========================
                      D_americana  ===========================
                     M. domestica  ===========================
                          D_hydei  ===========================
B D                  D. persimilis  ===========================
               Teleopsis_dalmanni  ===========================
               Zaprionus_indianus  ===========================
    Scaptodrosophila_lebanonensis  ===========================
                     T. castaneum  ===========================
                        D_serrata  ===========================
                        D_montana  ===========================

Inserts between block 47 and 48 in window
                      D_athabasca 23bp
                D_pseudoobscura_1 6bp
                       D. miranda 6bp
                     D_subobscura 23bp
                        D_obscura 24bp

Alignment block 48 of 1353 in window, 826951 - 826975, 25 bps 
B D                D. melanogaster  acgagtcctgccat---------------cc----------t--------tt-------gcagga
  D                    D. simulans  acgagtcctgccat---------------cc----------t--------tt-------gcagga
B D                   D. sechellia  acga--------at---------------cc----------t--------tt-------gcagga
                         D. erecta  tcgagtcctgccat---------------cc----------t--------tt-------gcagga
                         D. yakuba  acga--------gt---------------cc----------t--------tt-------gcagga
                     D. ficusphila  agga--gattactc---------------cc----------t--------tc-------gcagga
                     D. eugracilis  acga--------gt---------------tc----------t--------tt-------gcagta
                      D. biarmipes  at---------------------------cc----------t--------tt-------gcagga
                        D. suzukii  at---------------------------cc---------tt--------tt-------gcagga
                     D. takahashii  at---------------------------cc----------t--------tt-------gcagga
                        D. elegans  atgagtcctgccctctaacc--tca-ctccc--a------tt--------tt-------taagga
                       D. rhopaloa  tcgagtcctgccctctgacc--tca-ctccc---------tt--------tt-------tgagga
                       D. kikkawai  atca-------cgc---------------ct----------c--------ct-------gcagga
                    D. bipectinata  aataatcctgccatccggcccatcacccccc----------ttccgatggtt-------gcaaaa
                       D_athabasca  -----------------------------tc--acgccccgt--------ccatccttgacaaca
                 D_pseudoobscura_1  -----------------------------cc--aaccaccgc--------tc-------acagaa
                        D. miranda  -----------------------------cc--aaccaccgc--------tc-------acagaa
                  D. pseudoobscura  -----------------------------cc--aaccaccgc--------tc-------acagaa
                      D_subobscura  -----------------------------tc--acgccccgt--------ccatccttggcaact
                         D_obscura  -----------------------------tc--acgccccgt--------ctatccttggcaact
                          D_nasuta  -----------------------------tccggaataccgc--------cc----gtggcgata
                     D. albomicans  -----------------------------tccggaataccgc--------cc----gtggcgata
                    D. willistoni  =================================================================
                     D. grimshawi  =================================================================
                     D. ananassae  =================================================================
                       D_arizonae  =================================================================
                    D. mojavensis  =================================================================
                       D. virilis  =================================================================
                   D_novamexicana  =================================================================
        Proctacanthus_coquilletti  =================================================================
                Bactrocera_tryoni  =================================================================
               Belgica_antarctica  =================================================================
            Culicoides_sonorensis  =================================================================
                     A. mellifera  =================================================================
            Lutzomyia_longipalpis  =================================================================
               Chironomus_tentans  =================================================================
                        A_farauti  =================================================================
              Stomoxys_calcitrans  =================================================================
                 Bactrocera_oleae  =================================================================
               Ceratitis_capitata  =================================================================
                  Lucilia_cuprina  =================================================================
             Bactrocera_latifrons  =================================================================
              Bactrocera_dorsalis  =================================================================
            Zeugodacus_cucurbitae  =================================================================
                      D_americana  =================================================================
                     M. domestica  =================================================================
                          D_hydei  =================================================================
B D                  D. persimilis  =================================================================
               Teleopsis_dalmanni  =================================================================
               Zaprionus_indianus  =================================================================
    Scaptodrosophila_lebanonensis  =================================================================
                     T. castaneum  =================================================================
                        D_serrata  =================================================================
                        D_montana  =================================================================

Alignment block 49 of 1353 in window, 826976 - 826984, 9 bps 
B D                D. melanogaster  cgag-aagtc
  D                    D. simulans  cgag-aagtc
B D                   D. sechellia  cgag-aagtc
                         D. erecta  cgag-aagtc
                         D. yakuba  tgag-aagtt
                     D. ficusphila  catc-acgcc
                     D. eugracilis  cgaa-tagtc
                      D. biarmipes  cgag-cagtc
                        D. suzukii  cgag-aagtc
                     D. takahashii  cgaa-aagtc
                        D. elegans  caag-aagcc
                       D. rhopaloa  cgaa-aagcc
                         D_serrata  caga-aaccc
                       D. kikkawai  ------accc
                    D. bipectinata  cggc-agccc
                       D_athabasca  acca-aagc-
                 D_pseudoobscura_1  tgcg-cagc-
                        D. miranda  tgcg-cagc-
                  D. pseudoobscura  tgcg-cagc-
                      D_subobscura  gcca-aacc-
                         D_obscura  acca-aacc-
                          D_nasuta  tgtgtcagc-
                     D. albomicans  tgtgtcagc-
                    D. willistoni  ==========
                     D. grimshawi  ==========
                     D. ananassae  ==========
                       D_arizonae  ==========
                    D. mojavensis  ==========
                       D. virilis  ==========
                   D_novamexicana  ==========
        Proctacanthus_coquilletti  ==========
                Bactrocera_tryoni  ==========
               Belgica_antarctica  ==========
            Culicoides_sonorensis  ==========
                     A. mellifera  ==========
            Lutzomyia_longipalpis  ==========
               Chironomus_tentans  ==========
                        A_farauti  ==========
              Stomoxys_calcitrans  ==========
                 Bactrocera_oleae  ==========
               Ceratitis_capitata  ==========
                  Lucilia_cuprina  ==========
             Bactrocera_latifrons  ==========
              Bactrocera_dorsalis  ==========
            Zeugodacus_cucurbitae  ==========
                      D_americana  ==========
                     M. domestica  ==========
                          D_hydei  ==========
B D                  D. persimilis  ==========
               Teleopsis_dalmanni  ==========
               Zaprionus_indianus  ==========
    Scaptodrosophila_lebanonensis  ==========
                     T. castaneum  ==========
                        D_montana  ==========

Inserts between block 49 and 50 in window
                   D. bipectinata 13bp

Alignment block 50 of 1353 in window, 826985 - 827304, 320 bps 
B D                D. melanogaster  ca-ccc----tctcgctgcc--aaaaagccacca-----------cctcgc--agagattttgcgcag--
  D                    D. simulans  ca-ccc----tctcgttgcc--aaaaagccacca-----------cctcgc--agagattttgcgcag--
B D                   D. sechellia  ca-ccc----tctcgttgcc--aaaaagccacca-----------cctcgc--agagattttgcgcag--
                         D. erecta  ca-ccc----tctcgctgcc--aaaaagccacca-----------cctcgc--tgagattttgcgcag--
                         D. yakuba  ca-ccc----tctcgctgcc--aaaaagccacca-----------cctcgc--agagattttgcgcag--
                     D. ficusphila  ca-ccc----tctcgctgct--aaaaagccacca------------ctcgc--agtgattttgcgcag--
                     D. eugracilis  ca-ccc----tctcgctgccaaaaaaagccacca-----------cctcgt--agagattttgcgcag--
                      D. biarmipes  ca-ccc----tctcgccgcc--gaaaagccacca-----------cctcgc--agggattttgcgcag--
                        D. suzukii  ca-ccc----tctcgctgcc--aaaaagccaccc-----------cctcgc--agggattttgcgcag--
                     D. takahashii  ca-ccc----tctcgctgcc--aaaaagccacca-----------cctcgctgagagtttttgcgcag--
                        D. elegans  ga-ccc----tctcgctgcc--gaaaatccacca-----------cctcgc--agagattttgcgcag--
                       D. rhopaloa  at-ccc----tctcgctgcc--aaaaatccacca-----------cctcgc--agagattttgcgcag--
                         D_serrata  ca-ccccagacctggctgaa--agaaagccaccacca--------cctcgc--agggattttgcgcag--
                       D. kikkawai  ca-ccccagtcctggctgaa--agaaagccaccacca--------cctcgc--agagattttgcgcag--
                      D. ananassae  ca-tcc----tcctgcggca--aagccaccacca-----------cctcct--gcagattttgcgcag--
                    D. bipectinata  ca-tcc----tctggc-aca--aag---ccacca-----------cctcct--ggagattttgcgcagca
                       D_athabasca  aa-cca----cc--gctcgg--agaatgc--gcagcagctctcatgctctc--agatattc----ttt--
                 D_pseudoobscura_1  ag-ctc----tccggctctc--at---------------------gctctc--agatattccgtgcat--
                        D. miranda  ag-ctc----tccggctctc--at---------------------gctctc--agatattccgtgcat--
                  D. pseudoobscura  ag-ctc----tccggctctc--at---------------------gctctc--agatattccgtgcat--
                      D_subobscura  aa-cca----cc--gctcgc--agaatgc--gcagca--------gctctc--cgcctttc-gtgc----
                         D_obscura  aa-cca----cc--gctcgc--agaatgc--gcagca--------gctctc--cggcttta-gtgc----
                          D_nasuta  aatctg----ttcggctctc--gc---------------------gccc------gctttccgccccc--
                     D. albomicans  aatctg----ttcggctctc--gc---------------------gccc------gctttccgccccc--
                    D. willistoni  ======================================================================
                     D. grimshawi  ======================================================================
                       D_arizonae  ======================================================================
                    D. mojavensis  ======================================================================
                       D. virilis  ======================================================================
                   D_novamexicana  ======================================================================
        Proctacanthus_coquilletti  ======================================================================
                Bactrocera_tryoni  ======================================================================
               Belgica_antarctica  ======================================================================
            Culicoides_sonorensis  ======================================================================
                     A. mellifera  ======================================================================
            Lutzomyia_longipalpis  ======================================================================
               Chironomus_tentans  ======================================================================
                        A_farauti  ======================================================================
              Stomoxys_calcitrans  ======================================================================
                 Bactrocera_oleae  ======================================================================
               Ceratitis_capitata  ======================================================================
                  Lucilia_cuprina  ======================================================================
             Bactrocera_latifrons  ======================================================================
              Bactrocera_dorsalis  ======================================================================
            Zeugodacus_cucurbitae  ======================================================================
                      D_americana  ======================================================================
                     M. domestica  ======================================================================
                          D_hydei  ======================================================================
B D                  D. persimilis  ======================================================================
               Teleopsis_dalmanni  ======================================================================
               Zaprionus_indianus  ======================================================================
    Scaptodrosophila_lebanonensis  ======================================================================
                     T. castaneum  ======================================================================
                        D_montana  ======================================================================

                   D. melanogaster  ----catctctaaa------------------cga---------------aacggc------cggcaaat
                       D. simulans  ----catctctgaa------------------cca---------------aacggc------cggcaaat
                      D. sechellia  ----catctctgaa------------------cga---------------aacggc------cggcaaat
                         D. erecta  ----catctctgaa------------------cga---------------aacggc------cggcaaat
                         D. yakuba  ----caactcttta------------------gga---------------aacggc------cggcaaat
                     D. ficusphila  ----caactct------------------------------------------ggc------cggcaaaa
                     D. eugracilis  ----catctct----------------------ga---------------aacggc------cggcaacc
                      D. biarmipes  ----catctctgcgagg-----aatcca--atcgaggcggaacgagccgcaacggc------cggcaaat
                        D. suzukii  ----catctctgaaagg-----aatcga--atcga-----aacgaaccgaaacggc------cggcaaat
                     D. takahashii  ----catctctgaaagg-----aatcga--atcga-----aacga-----aacggc------cggcaaat
                        D. elegans  ----catctctggg------------------------------------cacggc------cggcaaat
                       D. rhopaloa  ----cttctcaggg------------------------------------cacggc------cggcaa--
                         D_serrata  ----cagctctctcgca-----gcgcagctctggg---------------cacggc------cggc----
                       D. kikkawai  ----cagctctctcgca-----gcgcagctctggg---------------cacggc------cggc----
                      D. ananassae  ----cagctctatgcagctctcg--cgactctggg---------------cacggc------c-------
                    D. bipectinata  gcatcagctctatgcagctctcgctcgactcgggg---------------cacggc------c-------
                       D_athabasca  ----gcatccatcc--------------------c---------------tacagc------c-------
                 D_pseudoobscura_1  ----ccatccctac------------------agc---------------cacagacacaggc-------
                        D. miranda  ----ccatccctac------------------agc---------------cacaga------c-------
                  D. pseudoobscura  ----ccatccctac------------------agc---------------cacaga------c-------
                      D_subobscura  ----------------------------------t---------------ctcaga------t-------
                         D_obscura  ----------------------------------t---------------ctcaga------t-------
                          D_nasuta  ----ttcaacaaac------------------aac---------------caccac------c-------
                     D. albomicans  ----ttcaacaaac------------------aac---------------caccac------c-------
                     D. willistoni  ======================================================================
                      D. grimshawi  ======================================================================
                        D_arizonae  ======================================================================
                     D. mojavensis  ======================================================================
                        D. virilis  ======================================================================
                    D_novamexicana  ======================================================================
         Proctacanthus_coquilletti  ======================================================================
                 Bactrocera_tryoni  ======================================================================
                Belgica_antarctica  ======================================================================
             Culicoides_sonorensis  ======================================================================
                      A. mellifera  ======================================================================
             Lutzomyia_longipalpis  ======================================================================
                Chironomus_tentans  ======================================================================
                         A_farauti  ======================================================================
               Stomoxys_calcitrans  ======================================================================
                  Bactrocera_oleae  ======================================================================
                Ceratitis_capitata  ======================================================================
                   Lucilia_cuprina  ======================================================================
              Bactrocera_latifrons  ======================================================================
               Bactrocera_dorsalis  ======================================================================
             Zeugodacus_cucurbitae  ======================================================================
                       D_americana  ======================================================================
                      M. domestica  ======================================================================
                           D_hydei  ======================================================================
                     D. persimilis  ======================================================================
                Teleopsis_dalmanni  ======================================================================
                Zaprionus_indianus  ======================================================================
     Scaptodrosophila_lebanonensis  ======================================================================
                      T. castaneum  ======================================================================
                         D_montana  ======================================================================

                   D. melanogaster  gtcgcaaactccctcgg-----------------------ca-ac-aaaagccaaaaaaaaaatacaaaa
                       D. simulans  gtcgcaaactccctcgg-----------------------ca-ac-aaaagccaga----------aaaa
                      D. sechellia  gtcgcaaactccctcgg-----------------------ca-ac-aaaagccaga----------aaaa
                         D. erecta  gtcacaaactccctcgg-----------------------ca-ac-aaaagccag-----------aaag
                         D. yakuba  gtcacaaactccctcgg-----------------------ca-ac-aaaagcgag-----------aaaa
                     D. ficusphila  gtcgcaaactccctcgg-----------------------ca-ac-aatccc--------------aaaa
                     D. eugracilis  gtcgcaaactccctcgg-----------------------ca-ac-aatcccga------------aaaa
                      D. biarmipes  gccgcagactccctcgg-----------------------ca-ac-aaagcccaa-----------aaaa
                        D. suzukii  gtcgcagactccctcgg-----------------------ca-ac-aaagcccaa-----------aaaa
                     D. takahashii  gtcgcagactccctcgg-----------------------ca-acaaaagcccaa-----------aaaa
                        D. elegans  gtgacagactccctcgg-----------------------ca-ac--aatcccaa-----------aaag
                       D. rhopaloa  -tgtcagactccctcgg-----------------------ca-ac--aatcccaa-----------aaaa
                         D_serrata  ------gactccctcgg-----------------------ca-ac-aaatcccga-----------aaaa
                       D. kikkawai  ------gactccctcgg-----------------------ca-ac-aaatcccga-----------aaaa
                      D. ananassae  ---acagactcccccggcaacactacaacaacatcatcaaca-ac--aacaacaa-----------caaa
                    D. bipectinata  ---acagactcccccgg-----------------------ca-ac--aataaaaa-----------caca
                       D_athabasca  ---acagacacagtcca-----------------------t--------agtcat--------------g
                 D_pseudoobscura_1  ---acaggcacagtcca-----------------------ta-gc-cacagccat--------------g
                        D. miranda  ---acaggcacagtcca-----------------------ta-gc-cacagccat--------------g
                  D. pseudoobscura  ---acaggcacagtcca-----------------------ta-gc-cacagccat--------------g
                      D_subobscura  ---actcgctgcatcca-----------------------tc-cc-tacagt------------------
                         D_obscura  ---attcgctgcatccc-----------------------tc-cc-tacagccac-------------ag
                          D_nasuta  ---gctaacgcgactct-----------------------cgttc-cacaatccacataattc---agaa
                     D. albomicans  ---gctaacgcgactct-----------------------cgttc-cacaatccacataattc---agaa
                     D. willistoni  ======================================================================
                      D. grimshawi  ======================================================================
                        D_arizonae  ======================================================================
                     D. mojavensis  ======================================================================
                        D. virilis  ======================================================================
                    D_novamexicana  ======================================================================
         Proctacanthus_coquilletti  ======================================================================
                 Bactrocera_tryoni  ======================================================================
                Belgica_antarctica  ======================================================================
             Culicoides_sonorensis  ======================================================================
                      A. mellifera  ======================================================================
             Lutzomyia_longipalpis  ======================================================================
                Chironomus_tentans  ======================================================================
                         A_farauti  ======================================================================
               Stomoxys_calcitrans  ======================================================================
                  Bactrocera_oleae  ======================================================================
                Ceratitis_capitata  ======================================================================
                   Lucilia_cuprina  ======================================================================
              Bactrocera_latifrons  ======================================================================
               Bactrocera_dorsalis  ======================================================================
             Zeugodacus_cucurbitae  ======================================================================
                       D_americana  ======================================================================
                      M. domestica  ======================================================================
                           D_hydei  ======================================================================
                     D. persimilis  ======================================================================
                Teleopsis_dalmanni  ======================================================================
                Zaprionus_indianus  ======================================================================
     Scaptodrosophila_lebanonensis  ======================================================================
                      T. castaneum  ======================================================================
                         D_montana  ======================================================================

                   D. melanogaster  tac-aaaaaac------------aaaaccga-------aacc--------gaaaccccattcgaatccca
                       D. simulans  tac-aaaaaac------------aaaaccga-------aacc--------gaacccccattcgaatccca
                      D. sechellia  tac-aaaaaac------------aaaaccga-------aacc--------gaaaccccattcgaatccca
                         D. erecta  tac-aaaaaac------------aaaaccga-aaacg-aaac--------gaaaccccattcgaatccca
                         D. yakuba  tac-aaaaaac------------aaaaccga-aactgaaacc--------gaaaccccattcaaatccca
                     D. ficusphila  tac-aaaaaac------------aataccga--accgaaccc--------aaaacgccattcgaatccca
                     D. eugracilis  tac-aaaaaac------------aaaaccga--------------------------------aatccca
                      D. biarmipes  tag-gaaaaac------------aaaaccg----------------------aatccca-----atccca
                        D. suzukii  tac-aaaaaac------------aaaaccga-------aacc--------gaaatccca-----atacca
                     D. takahashii  tacaaaaaaac------------aaaaccg---------------------aaatccca----gatccca
                        D. elegans  tag-aaaaagtaaaacaaagccgaaaaccga-------aaac--------gaaaccccattcgaatccca
                       D. rhopaloa  tac-aaaaaac------------aaaaccga-------aaac--------gaaaccccattcaaatccca
                         D_serrata  tac-ggaaaac------------aaagcccgaaacagaaccc--------gagacccaaacctaatccca
                       D. kikkawai  tac-ggaaaac------------aaagcccgaaacagaaacc--------gaaacccaaacctaatccca
                      D. ananassae  cac-ggagtgg------------agaattaa-------aaattaaaaaaaaaaagccaatacaaatccca
                    D. bipectinata  cac-gggctgg------------agaattaa-------aaac------gaaaaacccaatacaagtccca
                       D_athabasca  gcc-actcggc------------aacagcca-------atac--------gatacccaaatcgagtcccg
                 D_pseudoobscura_1  gcc-actcggc------------aacagcca-------atac----------tcccaaaatcgagtcccg
                        D. miranda  tcc-actcggc------------aacagcca-------atac----------tcccaaaatcgagtcccg
                  D. pseudoobscura  gcc-actcggc------------aacagcca-------atac----------tcccaaaatcgagtcccg
                      D_subobscura  -cc-actaggc------------aacagcca-------aagt-------ggactcccaaatcgaatcccg
                         D_obscura  tcc-actcggc------------aacagcca-------atcc-----------tcccaaatcgagtccca
                          D_nasuta  tcc-acacgac------------acaggtcg-------ctct----------ctactcgat--actcccg
                     D. albomicans  tcc-acacgac------------acaggtcg-------ctct----------ctactcgat--actcccg
                     D. willistoni  ======================================================================
                      D. grimshawi  ======================================================================
                        D_arizonae  ======================================================================
                     D. mojavensis  ======================================================================
                        D. virilis  ======================================================================
                    D_novamexicana  ======================================================================
         Proctacanthus_coquilletti  ======================================================================
                 Bactrocera_tryoni  ======================================================================
                Belgica_antarctica  ======================================================================
             Culicoides_sonorensis  ======================================================================
                      A. mellifera  ======================================================================
             Lutzomyia_longipalpis  ======================================================================
                Chironomus_tentans  ======================================================================
                         A_farauti  ======================================================================
               Stomoxys_calcitrans  ======================================================================
                  Bactrocera_oleae  ======================================================================
                Ceratitis_capitata  ======================================================================
                   Lucilia_cuprina  ======================================================================
              Bactrocera_latifrons  ======================================================================
               Bactrocera_dorsalis  ======================================================================
             Zeugodacus_cucurbitae  ======================================================================
                       D_americana  ======================================================================
                      M. domestica  ======================================================================
                           D_hydei  ======================================================================
                     D. persimilis  ======================================================================
                Teleopsis_dalmanni  ======================================================================
                Zaprionus_indianus  ======================================================================
     Scaptodrosophila_lebanonensis  ======================================================================
                      T. castaneum  ======================================================================
                         D_montana  ======================================================================

                   D. melanogaster  ttc-----c-cca--------g--caaaagcatctac-ttaatcaacccgggc-gggagtggactc----
                       D. simulans  ttc-----c-cca--------g--caaaagcatctac-ttaatcaact----c-gggagtagactc----
                      D. sechellia  ttc-----c-cca--------g--caaaagcatctac-ttaatcaact----c-gggagtagactc----
                         D. erecta  ttc-----c-cca--------g--caaatgcatctac-ttaatcaact----c-gggagtaaactt----
                         D. yakuba  ttc-----c-cca--------g--caaaagcatctac-ttaatcaactc---c-gggagtaaactt----
                     D. ficusphila  ttc-----c-cta--------g--cgaaagcatctac-ttaatcaaca----t-gggaatggagtt----
                     D. eugracilis  ttc-----ctcca--------g--cagtaacgtctac-ttaatcaact----t-gggagtaaagtt----
                      D. biarmipes  ctc-----t-ccg--------g-cc--aagcatctac-ttaatcaact----g-cggagcgaagtt----
                        D. suzukii  ttc-----c-cca--------g-ccaaaagcatctac-ttaatcaacc----t-gggagtgaagtt----
                     D. takahashii  ttc-----t-cca--------gaccaaaagcatctac-ttaatcaact----t-ggcagtagagtcggtt
                        D. elegans  ttc-----c-cca--------g--caaaagtatttac-ttaatcaact----tggggaatggagtt----
                       D. rhopaloa  ttc-----c-cct--------g--caaaagcatatac-ttaatcaact----ttgggaattgagtt----
                         D_serrata  ctc-----c-tca--------c--cagaagcgtctac-ttaatcaact----ccgagaatgggctt----
                       D. kikkawai  ctc-----c-tct--------c--cagaagcgtctac-ttaatcaact----ctgagaatgggctt----
                      D. ananassae  ttc-----c-c-------------------------c-ttaatcaact----c--gaaatgaagtt----
                    D. bipectinata  ttc-----c-c-------------------------c-ttaatcgact----c--gaaatgaagtt----
                       D_athabasca  att-----t-caatcccctccg--tacgaacaaattt-ttaatcaact----c-tcgaat----------
                 D_pseudoobscura_1  atc-----c-cca-atcctccg--tacaaacaaatgc-ttaatcaact----c-tcgaat----------
                        D. miranda  atc-----c-cca-atcctccg--tacaaacaaatgc-ttaatcaact----c-tcgaat----------
                  D. pseudoobscura  atc-----c-cca-atcctccg--tacaaacaaatgc-ttaatcaact----c-tcgaat----------
                      D_subobscura  atccaaatc-cca-atcctacg--tacaaacaaatgc-ttaatcaact----c-tcgaat----------
                         D_obscura  atcccaaac-cca-atcctccg--tacaaacaaatgc-ttaatcaact----c-tcgaat----------
                          D_nasuta  aaa-----c-caa-agaatgaa--gagtgatagatatgctgatcccat----a-ttgact----tc----
                     D. albomicans  aaa-----c-caa-agaatgaa--gagtgatagatatgctgatcccat----a-ttgact----tc----
                     D. willistoni  ======================================================================
                      D. grimshawi  ======================================================================
                        D_arizonae  ======================================================================
                     D. mojavensis  ======================================================================
                        D. virilis  ======================================================================
                    D_novamexicana  ======================================================================
         Proctacanthus_coquilletti  ======================================================================
                 Bactrocera_tryoni  ======================================================================
                Belgica_antarctica  ======================================================================
             Culicoides_sonorensis  ======================================================================
                      A. mellifera  ======================================================================
             Lutzomyia_longipalpis  ======================================================================
                Chironomus_tentans  ======================================================================
                         A_farauti  ======================================================================
               Stomoxys_calcitrans  ======================================================================
                  Bactrocera_oleae  ======================================================================
                Ceratitis_capitata  ======================================================================
                   Lucilia_cuprina  ======================================================================
              Bactrocera_latifrons  ======================================================================
               Bactrocera_dorsalis  ======================================================================
             Zeugodacus_cucurbitae  ======================================================================
                       D_americana  ======================================================================
                      M. domestica  ======================================================================
                           D_hydei  ======================================================================
                     D. persimilis  ======================================================================
                Teleopsis_dalmanni  ======================================================================
                Zaprionus_indianus  ======================================================================
     Scaptodrosophila_lebanonensis  ======================================================================
                      T. castaneum  ======================================================================
                         D_montana  ======================================================================

                   D. melanogaster  --cc--agctccct-gaatga---gtgatcttatgtaaaca-----------------------------
                       D. simulans  --cc--agccccct-gagtga---gtgatcttatgtaaaca-----------------------------
                      D. sechellia  --cc--agccccct-gaatga---gtgatcttatgtaaaca-----------------------------
                         D. erecta  --tc--agcccgct-gaatga---gtgatcttatgtaaaca-----------------------------
                         D. yakuba  --tt--agcccaca-gaatga---gtgatcttatgtaaaca-----------------------------
                     D. ficusphila  --gcggagcacact-gaatga---gtgatcttatgtaaaca-----------------------------
                     D. eugracilis  --tc--tacccact-gaatga---gtgatcttatgtaaaca-----------------------------
                      D. biarmipes  -------gcccacc-gattga---gtgatcttacgtaaaca-----------------------------
                        D. suzukii  --gc--agcccact-gaatga---gtgatcttatgtaaaca-----------------------------
                     D. takahashii  aggc--agcccact-gaatga---gtgatcttatgtaaaca-----------------------------
                        D. elegans  --gc--ggcccaagagaatga---gtgatcttatgtaaacag----------------------------
                       D. rhopaloa  --gc--ggcccaagagaatga---gtgatcttatgtaaaca-----------------------------
                         D_serrata  --ccacagcccaca-gaatga---gtgatcttatgtaaaca-----------------------------
                       D. kikkawai  --ccacagcccaca-gaatga---gtgatcttatgtaaaca-----------------------------
                      D. ananassae  --cc-tcggccgca-gaatga---gtgatcttatgtaaaca-----------------------------
                    D. bipectinata  --cc-tcggccgca-gaatga---gtgatcttacgtaaaca-----------------------------
                       D_athabasca  --gc-----ccaca-taataaatgatgatcttatgtaaacattgcggatgggcttcctctggcatcggtt
                 D_pseudoobscura_1  --gc-----ccaca-taatga---atgatcttatataaacattgcggatgggcttcctctgacatcggct
                        D. miranda  --gc-----ccaca-taatga---atgatcttatataaacattgcggatgggcttcctctgacatcggtt
                  D. pseudoobscura  --gc-----ccaca-taatga---atgatcttatataaacattgcggatgggcttcctctgacatcggct
                      D_subobscura  --gc-----ccaca-taataa---atgatcttatataaacattgcggatgggcttcctctggcatcggtt
                         D_obscura  --gc-----ccaca-taataa---atgatcttatataaacattccggatgggcttcctctagcatcggtt
                          D_nasuta  --gc-----tccca-agattt---atgtttatatgtag-------------------------ttctgct
                     D. albomicans  --gc-----tccca-agattt---atgtttatatgtag-------------------------ttctgct
                     D. willistoni  ======================================================================
                      D. grimshawi  ======================================================================
                        D_arizonae  ======================================================================
                     D. mojavensis  ======================================================================
                        D. virilis  ======================================================================
                    D_novamexicana  ======================================================================
         Proctacanthus_coquilletti  ======================================================================
                 Bactrocera_tryoni  ======================================================================
                Belgica_antarctica  ======================================================================
             Culicoides_sonorensis  ======================================================================
                      A. mellifera  ======================================================================
             Lutzomyia_longipalpis  ======================================================================
                Chironomus_tentans  ======================================================================
                         A_farauti  ======================================================================
               Stomoxys_calcitrans  ======================================================================
                  Bactrocera_oleae  ======================================================================
                Ceratitis_capitata  ======================================================================
                   Lucilia_cuprina  ======================================================================
              Bactrocera_latifrons  ======================================================================
               Bactrocera_dorsalis  ======================================================================
             Zeugodacus_cucurbitae  ======================================================================
                       D_americana  ======================================================================
                      M. domestica  ======================================================================
                           D_hydei  ======================================================================
                     D. persimilis  ======================================================================
                Teleopsis_dalmanni  ======================================================================
                Zaprionus_indianus  ======================================================================
     Scaptodrosophila_lebanonensis  ======================================================================
                      T. castaneum  ======================================================================
                         D_montana  ======================================================================

                   D. melanogaster  ---------------gg--------------ctgccctt--tgcctcc-------cac---gccccgaga
                       D. simulans  ---------------gg--------------ctgccctt--tgcctcc-------cac---gccccgaca
                      D. sechellia  ---------------gg--------------ctgccctt--tgcctcc-------cac---gccccgaga
                         D. erecta  ---------------gg--------------ctgccctt--tgcctcc-------cac---gccccaaga
                         D. yakuba  ---------------gg--------------ctgccctt--tgcctcccacgccacac---gccccaaga
                     D. ficusphila  ---------------gc--------------ctgccctc--tgcctcc-------cac---gac------
                     D. eugracilis  ---------------gg--------------ctgccctt--tccctcc-------cac---gcc------
                      D. biarmipes  ---------------gg--------------ctgccctt--tgcctcc-------cac---gcc------
                        D. suzukii  ---------------gg--------------ctgcccct--tgcctcc-------cac---gcc------
                     D. takahashii  ---------------ggctgc----------ctgccctt--tgcctcc-------cac---gcc------
                        D. elegans  ---------------gg--------------gcgccctt--tgcctcc-------cac---gac------
                       D. rhopaloa  ---------------gg--------------ctgccctt--tgcctcg-------aac---gac------
                         D_serrata  ---------------ggccacgggtgaggggctgccctt--tgcctcc-------cac---gac-tgact
                       D. kikkawai  ---------------ggccacggatgaggggctgccctt--tgcctcc-------cac---aac-tggct
                      D. ananassae  ---------------ggccgtactgctggg-atgccctctccgcctcc-------cac---gac------
                    D. bipectinata  ---------------ga------------------------ggccgcc-------ctc---gac------
                       D_athabasca  t-----------tgtgg--------------ctgccctt--tgcctca-------cac---gac------
                 D_pseudoobscura_1  tctgtggctggctgctg--------------ctgccctt--tgcctcg-------tgc---gac------
                        D. miranda  tctgtggctggctgctg--------------ctgccctt--tgcctcg-------cgc---gac------
                  D. pseudoobscura  tctgtggctggctgctg--------------ctgccctt--tgcctcg-------cgc---gac------
                      D_subobscura  t-tgtggcttg--gctg--------------ctgccctt--tgcctcg-------cgc---gac------
                         D_obscura  t-tgtg-------tctg--------------ttggcctt--tgcctcg-------cgc---gac------
                          D_nasuta  t-----------tgtgg--------------ctgccctta-tgcctcg-------ccccttgtc------
                     D. albomicans  t-----------tgtgg--------------ctgccctta-tgcctcg-------ccccttgtc------
                     D. willistoni  ======================================================================
                      D. grimshawi  ======================================================================
                        D_arizonae  ======================================================================
                     D. mojavensis  ======================================================================
                        D. virilis  ======================================================================
                    D_novamexicana  ======================================================================
         Proctacanthus_coquilletti  ======================================================================
                 Bactrocera_tryoni  ======================================================================
                Belgica_antarctica  ======================================================================
             Culicoides_sonorensis  ======================================================================
                      A. mellifera  ======================================================================
             Lutzomyia_longipalpis  ======================================================================
                Chironomus_tentans  ======================================================================
                         A_farauti  ======================================================================
               Stomoxys_calcitrans  ======================================================================
                  Bactrocera_oleae  ======================================================================
                Ceratitis_capitata  ======================================================================
                   Lucilia_cuprina  ======================================================================
              Bactrocera_latifrons  ======================================================================
               Bactrocera_dorsalis  ======================================================================
             Zeugodacus_cucurbitae  ======================================================================
                       D_americana  ======================================================================
                      M. domestica  ======================================================================
                           D_hydei  ======================================================================
                     D. persimilis  ======================================================================
                Teleopsis_dalmanni  ======================================================================
                Zaprionus_indianus  ======================================================================
     Scaptodrosophila_lebanonensis  ======================================================================
                      T. castaneum  ======================================================================
                         D_montana  ======================================================================

                   D. melanogaster  t--ccagata--aga---------------------gtg---------------c---------------
                       D. simulans  t--ccagata--aga---------------------gtg---------------c---------------
                      D. sechellia  t--ccagata--aga---------------------gtg---------------c---------------
                         D. erecta  t--ccagata--aga---------------------gtg---------------c---------------
                         D. yakuba  t--ccagata--aga---------------------gtg---------------c---------------
                     D. ficusphila  t--ccagata--agaccatttcgtatatgtag----gtg---------------c---------------
                     D. eugracilis  a--ccagata--aga---------------------gtg---------------c---------------
                      D. biarmipes  c--ccagata--aga---------------------ctg---------------c---------------
                        D. suzukii  c--ccagata--aga---------------------ctg---------------c---------------
                     D. takahashii  c--ccagata--aga---------------------ctg---------------c---------------
                        D. elegans  a--ccagataagaga---------------------ctg---------------ctc-------------
                       D. rhopaloa  a--ccagata--aga---------------------ctg---------------ctc-------------
                         D_serrata  c--ccagata--agccc-------------------ctg---------------ctc-------------
                       D. kikkawai  c--ccagata--agccc-------------------ctg---------------ccc-------------
                      D. ananassae  accccagata--agcgcctgccctccgccct-----ctg---------------ctt-------------
                    D. bipectinata  a--ccagata--agcgcctgccctccaccctgccaccag---------------ctc-------------
                       D_athabasca  a--ccagata--aca---------------------ctc---------------ctcctcctccgctcag
                 D_pseudoobscura_1  a--ccagata--aca---------------------ctg------ctcctcctcctcctcctgcactcag
                        D. miranda  a--ccagata--aca---------------------ctg---ctcctcctcctcctcctcctgcactcag
                  D. pseudoobscura  a--ccagata--aca---------------------ctgctcctcctcctcctcctcctcctgcactcag
                      D_subobscura  a--ccagata--aca---------------------ctc---------------ctccac----------
                         D_obscura  a--ccagata--aca---------------------ctc---------------ctctact------cag
                          D_nasuta  a--gcagata--acg---------------------caa---------------c---------------
                     D. albomicans  a--gcagata--acg---------------------caa---------------c---------------
                     D. willistoni  ======================================================================
                      D. grimshawi  ======================================================================
                        D_arizonae  ======================================================================
                     D. mojavensis  ======================================================================
                        D. virilis  ======================================================================
                    D_novamexicana  ======================================================================
         Proctacanthus_coquilletti  ======================================================================
                 Bactrocera_tryoni  ======================================================================
                Belgica_antarctica  ======================================================================
             Culicoides_sonorensis  ======================================================================
                      A. mellifera  ======================================================================
             Lutzomyia_longipalpis  ======================================================================
                Chironomus_tentans  ======================================================================
                         A_farauti  ======================================================================
               Stomoxys_calcitrans  ======================================================================
                  Bactrocera_oleae  ======================================================================
                Ceratitis_capitata  ======================================================================
                   Lucilia_cuprina  ======================================================================
              Bactrocera_latifrons  ======================================================================
               Bactrocera_dorsalis  ======================================================================
             Zeugodacus_cucurbitae  ======================================================================
                       D_americana  ======================================================================
                      M. domestica  ======================================================================
                           D_hydei  ======================================================================
                     D. persimilis  ======================================================================
                Teleopsis_dalmanni  ======================================================================
                Zaprionus_indianus  ======================================================================
     Scaptodrosophila_lebanonensis  ======================================================================
                      T. castaneum  ======================================================================
                         D_montana  ======================================================================

                   D. melanogaster  -------------------------------------------cccactttcagt---------------
                       D. simulans  -------------------------------------------cccacttttagt---------------
                      D. sechellia  -------------------------------------------cccacttttagt---------------
                         D. erecta  -------------------------------------------cccactttcagt---------------
                         D. yakuba  -------------------------------------------cccactttcagt---------------
                     D. ficusphila  -------------------------------------------cccactttcagt---------------
                     D. eugracilis  -------------------------------------------cccactttcg-----------------
                      D. biarmipes  -------------------------------------------cccactttcagt---------------
                        D. suzukii  -------------------------------------------cccactttcagt---------------
                     D. takahashii  -------------------------------------------cccactttcagt---------------
                        D. elegans  --------------------cacac------------aaatggcccactttcagt---------------
                       D. rhopaloa  --------------------cacgc------------aaatggcccactttcagt---------------
                         D_serrata  --------------------catgc------------agatggcccacttttggt---------------
                       D. kikkawai  --------------------catgc------------agctggcccacttttagt---------------
                      D. ananassae  --------------------ccagc------------agatgccccactttcgat---------------
                    D. bipectinata  --------------------ccagc------------agatgccccactttcgat---------------
                       D_athabasca  actctgaatgcaatcccccctctgccacatttc----gattgccccactttctgttctgt----------
                 D_pseudoobscura_1  actctgaatccaatcccccttctgccacattta----ggttgccccactttctgttctgctccgttctgt
                        D. miranda  actctgaaaccagtcccccttatgccacattta----ggttgccccactttctgttctgctccgttctgt
                  D. pseudoobscura  actctgaatccaatcccccttcagccacattta----ggttgccccactttctgttctgctccgttctgt
                      D_subobscura  ----------gaatccccctctcacagccttcactgggtttgccccactttctgttct------------
                         D_obscura  actctgaatcg----ccccatctgccacatttg----ggttgccccactttctgttctgt----------
                          D_nasuta  -------------------------------------gactgctctattttctgtgatttaagagctt--
                     D. albomicans  -------------------------------------gtctgctctattttctgtgatttaagagctt--
                     D. willistoni  ======================================================================
                      D. grimshawi  ======================================================================
                        D_arizonae  ======================================================================
                     D. mojavensis  ======================================================================
                        D. virilis  ======================================================================
                    D_novamexicana  ======================================================================
         Proctacanthus_coquilletti  ======================================================================
                 Bactrocera_tryoni  ======================================================================
                Belgica_antarctica  ======================================================================
             Culicoides_sonorensis  ======================================================================
                      A. mellifera  ======================================================================
             Lutzomyia_longipalpis  ======================================================================
                Chironomus_tentans  ======================================================================
                         A_farauti  ======================================================================
               Stomoxys_calcitrans  ======================================================================
                  Bactrocera_oleae  ======================================================================
                Ceratitis_capitata  ======================================================================
                   Lucilia_cuprina  ======================================================================
              Bactrocera_latifrons  ======================================================================
               Bactrocera_dorsalis  ======================================================================
             Zeugodacus_cucurbitae  ======================================================================
                       D_americana  ======================================================================
                      M. domestica  ======================================================================
                           D_hydei  ======================================================================
                     D. persimilis  ======================================================================
                Teleopsis_dalmanni  ======================================================================
                Zaprionus_indianus  ======================================================================
     Scaptodrosophila_lebanonensis  ======================================================================
                      T. castaneum  ======================================================================
                         D_montana  ======================================================================

                   D. melanogaster  -------tcctc----------c---at--ggct---gccccatc--------------------c
                       D. simulans  -------tcctc----------c---at--ggct---gccccatc--------------------c
                      D. sechellia  -------tcctc----------c---at--ggct---gcgccatc--------------------c
                         D. erecta  -------tcctc----------c---tt--gcct---gccccatc---------------------
                         D. yakuba  -------tcctc----------c---tt--ggct---gccccatccacccattcatccattcaccc
                     D. ficusphila  -------tcccc----------cgaaaa--gttt---accccctc---------------------
                     D. eugracilis  ---------ctc----------c----------------cccatc---------------------
                      D. biarmipes  -------tcccc----------c---agctcctg---gccccacc--------------------c
                        D. suzukii  -------tcctc----------c---tg--cctg---gccccatc--------------------c
                     D. takahashii  -------tgctc----------c---tc--cttggctgccccact--------------------c
                        D. elegans  -------tcctc----------c---at--ttct---tccctacc--------------------c
                       D. rhopaloa  -------tcctt----------c---tt--ttct---c----------------------------
                         D_serrata  -------tcctc----------c---tc--ctcc---tccacctt--------------------c
                       D. kikkawai  -------ttctc----------c---tc--cccc---tccacttc--------------------c
                      D. ananassae  -------tctccgcccccgc--c---ga--ctgt---gcccctt----------------------
                    D. bipectinata  -------tctccgccccctcctc---gc--atgt---gcccctt----------------------
                       D_athabasca  -------tcccc----------c---at--tc----------------------------------
                 D_pseudoobscura_1  tctgttcccccc----------c---at--tc----------------------------------
                        D. miranda  tctgtg-ccccc----------c---at--tc----------------------------------
                  D. pseudoobscura  tctgtgcccccc----------c---at--tc----------------------------------
                      D_subobscura  -ctgttctcccc----------c---at--tc----------------------------------
                         D_obscura  -------tcccc----------c---at--tc----------------------------------
                          D_nasuta  -------gtccc----------c---at--tc----------------------------------
                     D. albomicans  -------gtccc----------c---at--tc----------------------------------
                     D. willistoni  ==================================================================
                      D. grimshawi  ==================================================================
                        D_arizonae  ==================================================================
                     D. mojavensis  ==================================================================
                        D. virilis  ==================================================================
                    D_novamexicana  ==================================================================
         Proctacanthus_coquilletti  ==================================================================
                 Bactrocera_tryoni  ==================================================================
                Belgica_antarctica  ==================================================================
             Culicoides_sonorensis  ==================================================================
                      A. mellifera  ==================================================================
             Lutzomyia_longipalpis  ==================================================================
                Chironomus_tentans  ==================================================================
                         A_farauti  ==================================================================
               Stomoxys_calcitrans  ==================================================================
                  Bactrocera_oleae  ==================================================================
                Ceratitis_capitata  ==================================================================
                   Lucilia_cuprina  ==================================================================
              Bactrocera_latifrons  ==================================================================
               Bactrocera_dorsalis  ==================================================================
             Zeugodacus_cucurbitae  ==================================================================
                       D_americana  ==================================================================
                      M. domestica  ==================================================================
                           D_hydei  ==================================================================
                     D. persimilis  ==================================================================
                Teleopsis_dalmanni  ==================================================================
                Zaprionus_indianus  ==================================================================
     Scaptodrosophila_lebanonensis  ==================================================================
                      T. castaneum  ==================================================================
                         D_montana  ==================================================================

Inserts between block 50 and 51 in window
                     D. biarmipes 15bp
                       D. suzukii 5bp
                    D. takahashii 13bp
                      D. rhopaloa 3bp
                        D_serrata 9bp
                      D. kikkawai 9bp
                      D_athabasca 2bp
                D_pseudoobscura_1 2bp
                       D. miranda 2bp
                 D. pseudoobscura 2bp
                     D_subobscura 2bp
                        D_obscura 2bp
                         D_nasuta 2bp
                    D. albomicans 2bp

Alignment block 51 of 1353 in window, 827305 - 827308, 4 bps 
B D                D. melanogaster  atcc
  D                    D. simulans  atcc
B D                   D. sechellia  attc
                         D. erecta  ---c
                         D. yakuba  atcc
                     D. ficusphila  --gc
                        D. elegans  ---c
                         D_serrata  agcc
                       D. kikkawai  agcc
                      D. ananassae  -ggc
                    D. bipectinata  -cgc
                       D_athabasca  atcg
                 D_pseudoobscura_1  atcg
                        D. miranda  atcg
                  D. pseudoobscura  atcg
                      D_subobscura  atcg
                         D_obscura  atcg
                          D_nasuta  attt
                     D. albomicans  attt
                    D. willistoni  ====
                     D. grimshawi  ====
                     D. biarmipes  ====
                       D_arizonae  ====
                    D. mojavensis  ====
                       D. virilis  ====
                   D_novamexicana  ====
        Proctacanthus_coquilletti  ====
                Bactrocera_tryoni  ====
               Belgica_antarctica  ====
            Culicoides_sonorensis  ====
                     A. mellifera  ====
            Lutzomyia_longipalpis  ====
               Chironomus_tentans  ====
                        A_farauti  ====
              Stomoxys_calcitrans  ====
                 Bactrocera_oleae  ====
               Ceratitis_capitata  ====
                  Lucilia_cuprina  ====
             Bactrocera_latifrons  ====
              Bactrocera_dorsalis  ====
            Zeugodacus_cucurbitae  ====
                      D_americana  ====
                     M. domestica  ====
                      D. rhopaloa  ====
                    D. takahashii  ====
                    D. eugracilis  ----
                          D_hydei  ====
B D                  D. persimilis  ====
               Teleopsis_dalmanni  ====
               Zaprionus_indianus  ====
    Scaptodrosophila_lebanonensis  ====
                     T. castaneum  ====
                        D_montana  ====
                       D. suzukii  ====

Inserts between block 51 and 52 in window
                       D. elegans 5bp
                        D_serrata 2bp
                      D. kikkawai 2bp
                     D. ananassae 1bp
                   D. bipectinata 1bp

Alignment block 52 of 1353 in window, 827309 - 827391, 83 bps 
B D                D. melanogaster  --------accgaag---tcgtaactcaatgttataga-cc--ca-aatgctc--ccgtttc--------
  D                    D. simulans  --------acccaag---tcgtaactcaatgttataga-cc--ca-aatgctc--ccatttc--------
B D                   D. sechellia  --------acccaag---tcgtaactcaatgttataga-cc--ca-aatgctc--ccatttc--------
                         D. erecta  --------acccaag---tcgtaactcaatgttatagg-cc--ca-aatgctc--ccatttc--------
                         D. yakuba  --------acccaag---tcgtaactcaatgttataga-cc--ca-aatgctc--ccatttc--------
                     D. ficusphila  --------aaccaag---tcgtaactcagtgttataga-cc--ca-aatgctc--ccatttt--------
                     D. eugracilis  ------------aag---tcgtaactcaatgttataga-cc--ca-aatgctc--ccatttc--------
                      D. biarmipes  --------ccccaac---tcatagctcaatggtgtgga-cc--cg-agtgctc--ccgtttc--------
                        D. suzukii  --------ccccaac---tcataactcaatgttataga-cc--ca-aatgctc--ccatttc--------
                     D. takahashii  --------cccctgg---tcgtaactcaatgttatagaccc--ca-aatgctc--ccattttcggtgggc
                        D. elegans  --------atccaag---tcgtaactcaatgttataga-cc--ca-aatgctc--tcatttc--------
                       D. rhopaloa  --------atccaag---tcgtaactcaatgttataga-cc--ca-aatgctc--tcatttc--------
                         D_serrata  --------aaccaag---tcgtaactcaatgttataga-actata-aatgctc--ccattta--------
                       D. kikkawai  --------aacccag---tcgtaactcaatgttataga-actata-aatgctc--ccattta--------
                      D. ananassae  --------gccagag---tcgtaactcactcggataga-ac--ag-aatg-gc--ccgtttt--------
                    D. bipectinata  --------g-gagag---tcgtaactcactcggataga-ac--tgaaatg-gc--ccatttt--------
                       D_athabasca  at--ccggagtcggt---ccgcgactca---ttacaga-gc--at-aattctcctccgtttt--------
                 D_pseudoobscura_1  at-cccggagtcggc---tcgcgactta---ttacaga-gt--at-aattctcctccgtttt--------
                        D. miranda  at-cccggagtcggt---tcgcgactta---ttacaga-gt--at-aattctcctccgtttt--------
                  D. pseudoobscura  at-cccggagtcggt---tcgcgactta---ttacaga-gt--at-aattctcctctgtttt--------
                      D_subobscura  at--ccggagtcggtctgctgcgactta---ttacaga-gc--at-aattctcctccgtttt--------
                         D_obscura  aa--ccggagtcggt---ctgtgacttg---ttacagg-gc--at-aattctccgccgtttt--------
                          D_nasuta  cccctccccgttgcc---ttgcctccca---tttc--------tc-ctttcccctctgcttt--------
                     D. albomicans  cccctccccgttgcc---ttgcctccca---tttc--------tc-ctttcccctctgcttt--------
                    D. willistoni  ======================================================================
                     D. grimshawi  ======================================================================
                       D_arizonae  ======================================================================
                    D. mojavensis  ======================================================================
                       D. virilis  ======================================================================
                   D_novamexicana  ======================================================================
        Proctacanthus_coquilletti  ======================================================================
                Bactrocera_tryoni  ======================================================================
               Belgica_antarctica  ======================================================================
            Culicoides_sonorensis  ======================================================================
                     A. mellifera  ======================================================================
            Lutzomyia_longipalpis  ======================================================================
               Chironomus_tentans  ======================================================================
                        A_farauti  ======================================================================
              Stomoxys_calcitrans  ======================================================================
                 Bactrocera_oleae  ======================================================================
               Ceratitis_capitata  ======================================================================
                  Lucilia_cuprina  ======================================================================
             Bactrocera_latifrons  ======================================================================
              Bactrocera_dorsalis  ======================================================================
            Zeugodacus_cucurbitae  ======================================================================
                      D_americana  ======================================================================
                     M. domestica  ======================================================================
                          D_hydei  ======================================================================
B D                  D. persimilis  ======================================================================
               Teleopsis_dalmanni  ======================================================================
               Zaprionus_indianus  ======================================================================
    Scaptodrosophila_lebanonensis  ======================================================================
                     T. castaneum  ======================================================================
                        D_montana  ======================================================================

                   D. melanogaster  --ggg---------gc--caccaattcg----------ttc-g----------tgatggcttttctt--g
                       D. simulans  --ggg---------gc--caccgattcg----------ttc-g----------tgatggcttttctt--g
                      D. sechellia  --ggg---------gc--caccgattcg----------ttc-g----------tggtggcttttctt--g
                         D. erecta  --ggg---------gc--caccaatttg----------ttc-g----------tgatggcttttctt--g
                         D. yakuba  --ggg---------gc--caccgatttg----------ttc-g----------tgatggcttttctt--g
                     D. ficusphila  -gggg---------gc--caccaatttg----------ctt-g----------tgattg---ttttc--g
                     D. eugracilis  --ggg---------gc--caccaatttg----------ttt-g----------tgatggctt---tc--g
                      D. biarmipes  --ggg---------gc--caccaattgg----------cctgg----------ggatggctc---tc--g
                        D. suzukii  ggggg---------gc--caccaatttg----------ctt-g----------tgatggctt---ccaga
                     D. takahashii  ggggg---------gc--caccaatttg----------ttt-g----------tgatggttt---tcaga
                        D. elegans  -gggg---------gc--caccaatttg----------ttt-a----------tgatggttt---tc--g
                       D. rhopaloa  -gggg---------gc--ctccaatttg----------ttt-g----------tgatggttt---tc--g
                         D_serrata  -cggg---------gc--caccaatttg----------ttt-g----------tgaaggagg-------a
                       D. kikkawai  -cggg---------gc--caccaatttg----------ttt-g----------ccacggagg-------a
                      D. ananassae  --tggggcagccctgc--cagcagattg----------gtg-g----------c-agggctt---cc--t
                    D. bipectinata  --ggg---------gc--caccaatctg----------ctg-g----------c-agggctt---cc--t
                       D_athabasca  ---gt---------gc--ttccaatttg----------ttc-g----------tgattgttt---tt--a
                 D_pseudoobscura_1  ---gt---------gc--ttccaatttgt---------ttt-g----------tgattgttt---tt--a
                        D. miranda  ---gt---------gc--ttccaatttgt---------ttt-g----------tgattgttt---tt--a
                  D. pseudoobscura  ---gt---------gc--ttccaatttgt---------ttt-g----------tgattgttt---tt--a
                      D_subobscura  ---gt---------gccttcccaatttg----------ttt-g----------tgattgttt---tt--a
                         D_obscura  ---gt---------gc--ttccaatttg----------ttt-g----------tgattgttt---tt--a
                          D_nasuta  ---gt---------tatttttcaatttgtttcaataagttt-ggggctagttttgagtgttt---ct--t
                     D. albomicans  ---gt---------tatttttcaatttgtttcaataagttt-ggggccagttttgagtgttt---ct--t
                     D. willistoni  ======================================================================
                      D. grimshawi  ======================================================================
                        D_arizonae  ======================================================================
                     D. mojavensis  ======================================================================
                        D. virilis  ======================================================================
                    D_novamexicana  ======================================================================
         Proctacanthus_coquilletti  ======================================================================
                 Bactrocera_tryoni  ======================================================================
                Belgica_antarctica  ======================================================================
             Culicoides_sonorensis  ======================================================================
                      A. mellifera  ======================================================================
             Lutzomyia_longipalpis  ======================================================================
                Chironomus_tentans  ======================================================================
                         A_farauti  ======================================================================
               Stomoxys_calcitrans  ======================================================================
                  Bactrocera_oleae  ======================================================================
                Ceratitis_capitata  ======================================================================
                   Lucilia_cuprina  ======================================================================
              Bactrocera_latifrons  ======================================================================
               Bactrocera_dorsalis  ======================================================================
             Zeugodacus_cucurbitae  ======================================================================
                       D_americana  ======================================================================
                      M. domestica  ======================================================================
                           D_hydei  ======================================================================
                     D. persimilis  ======================================================================
                Teleopsis_dalmanni  ======================================================================
                Zaprionus_indianus  ======================================================================
     Scaptodrosophila_lebanonensis  ======================================================================
                      T. castaneum  ======================================================================
                         D_montana  ======================================================================

                   D. melanogaster  ggg-------------------------------------------------a
                       D. simulans  ggg-------------------------------------------------a
                      D. sechellia  ggg-------------------------------------------------a
                         D. erecta  ggg-------------------------------------------------a
                         D. yakuba  ggg-------------------------------------------------a
                     D. ficusphila  ggg-------------------------------------------------g
                     D. eugracilis  ggg-------------------------------------------------g
                      D. biarmipes  ggg-------------------------------------------------t
                        D. suzukii  ggg-------------------------------------------------t
                     D. takahashii  ggg-------------------------------------------------t
                        D. elegans  ggg-------------------------------------------------g
                       D. rhopaloa  ggg-------------------------------------------------g
                         D_serrata  gga-------------------------------------------------g
                       D. kikkawai  gga-------------------------------------------------g
                      D. ananassae  gaa-------------------------------------------------g
                    D. bipectinata  gga-------------------------------------------------g
                       D_athabasca  ggg--------------------------------------------------
                 D_pseudoobscura_1  ggg--------------------------------------------------
                        D. miranda  ggg--------------------------------------------------
                  D. pseudoobscura  ggg--------------------------------------------------
                      D_subobscura  ggg--------------------------------------------------
                         D_obscura  ggg--------------------------------------------------
                          D_nasuta  gatatgctcgctgcgtcttctccgtcttggtcttcgtctccgtgtttgttga-
                     D. albomicans  gatatgctcgctgcgtcttctccgtcttggtcttcgtctccgtgtttgttga-
                     D. willistoni  =====================================================
                      D. grimshawi  =====================================================
                        D_arizonae  =====================================================
                     D. mojavensis  =====================================================
                        D. virilis  =====================================================
                    D_novamexicana  =====================================================
         Proctacanthus_coquilletti  =====================================================
                 Bactrocera_tryoni  =====================================================
                Belgica_antarctica  =====================================================
             Culicoides_sonorensis  =====================================================
                      A. mellifera  =====================================================
             Lutzomyia_longipalpis  =====================================================
                Chironomus_tentans  =====================================================
                         A_farauti  =====================================================
               Stomoxys_calcitrans  =====================================================
                  Bactrocera_oleae  =====================================================
                Ceratitis_capitata  =====================================================
                   Lucilia_cuprina  =====================================================
              Bactrocera_latifrons  =====================================================
               Bactrocera_dorsalis  =====================================================
             Zeugodacus_cucurbitae  =====================================================
                       D_americana  =====================================================
                      M. domestica  =====================================================
                           D_hydei  =====================================================
                     D. persimilis  =====================================================
                Teleopsis_dalmanni  =====================================================
                Zaprionus_indianus  =====================================================
     Scaptodrosophila_lebanonensis  =====================================================
                      T. castaneum  =====================================================
                         D_montana  =====================================================

Inserts between block 52 and 53 in window
                      D_athabasca 136bp
                D_pseudoobscura_1 138bp
                       D. miranda 148bp
                 D. pseudoobscura 138bp
                     D_subobscura 89bp
                        D_obscura 135bp

Alignment block 53 of 1353 in window, 827392 - 827424, 33 bps 
B D                D. melanogaster  -----------------cc-------------aat--------------gact--------at-------
  D                    D. simulans  -----------------cc-------------agt--------------ggct--------at-------
B D                   D. sechellia  -----------------cc-------------agt--------------ggct--------at-------
                         D. erecta  -----------------cc-------------agt--------------ggct--------at-------
                         D. yakuba  -----------------cc-------------agt--------------ggct--------at-------
                     D. ficusphila  -----------------ccgcaacgcgtgcatagt--------------agc----------t-------
                     D. eugracilis  -----------------ct-------------agt--------------gacg--------at-------
                      D. biarmipes  -----------------ct-------------ggt--------------ggcc--------gc-------
                        D. suzukii  -----------------ct-------------ggt--------------agct--------ac-------
                     D. takahashii  -----------------ct-------------agt--------------ggcc--------at-------
                        D. elegans  -----------------ct-------------agt--------------agctggtggctact-------
                       D. rhopaloa  -----------------ct-------------agt--------------agc---------ca-------
                         D_serrata  -----------------cc-------------ccc--------------actg--------ct-------
                       D. kikkawai  -----------------cc-------------acc--------------actg--------ct-------
                      D. ananassae  -----------------tg-------------gtc--------------acag--------at-------
                    D. bipectinata  -----------------ta-------------gca--------------gcag--------at-------
                       D_athabasca  -----------------cc-------------atc---caatccaatccaatc--------cc-------
                 D_pseudoobscura_1  -----------------cc-------------atc----------------tc--------ca-------
                        D. miranda  -----------------cc-------------atc----------------tc--------ca-------
B D                  D. persimilis  ------------------c-------------gtc----------------tc--------ca-------
                  D. pseudoobscura  -----------------cc-------------atc----------------tc--------ca-------
                      D_subobscura  -----------------ct-------------gcctaccgtttctggcccatc--------caattccac
                         D_obscura  -----------------cc-------------atc--------caatccaatc--------tc-------
                          D_nasuta  ttggaacgaacacacttcc-------------gcc----------------tc--------ca-------
                     D. albomicans  ttggaacgaacacacttcc-------------gcc----------------tc--------ca-------
                    D. willistoni  ======================================================================
                     D. grimshawi  ======================================================================
                       D_arizonae  ======================================================================
                    D. mojavensis  ======================================================================
                       D. virilis  ======================================================================
                   D_novamexicana  ======================================================================
        Proctacanthus_coquilletti  ======================================================================
                Bactrocera_tryoni  ======================================================================
               Belgica_antarctica  ======================================================================
            Culicoides_sonorensis  ======================================================================
                     A. mellifera  ======================================================================
            Lutzomyia_longipalpis  ======================================================================
               Chironomus_tentans  ======================================================================
                        A_farauti  ======================================================================
              Stomoxys_calcitrans  ======================================================================
                 Bactrocera_oleae  ======================================================================
               Ceratitis_capitata  ======================================================================
                  Lucilia_cuprina  ======================================================================
             Bactrocera_latifrons  ======================================================================
              Bactrocera_dorsalis  ======================================================================
            Zeugodacus_cucurbitae  ======================================================================
                      D_americana  ======================================================================
                     M. domestica  ======================================================================
                          D_hydei  ======================================================================
               Teleopsis_dalmanni  ======================================================================
               Zaprionus_indianus  ======================================================================
    Scaptodrosophila_lebanonensis  ======================================================================
                     T. castaneum  ======================================================================
                        D_montana  ======================================================================

                   D. melanogaster  ---actccct-cgtctggaaccg------atc
                       D. simulans  ---actccct-cgcctggaaccg------atc
                      D. sechellia  ---actccct-cgcctggaaccg------atc
                         D. erecta  ---actccct-cgcctggaaccg------atc
                         D. yakuba  ---actccct-cgcctggaaccg------atc
                     D. ficusphila  ---actccctccatctggaaccg------atc
                     D. eugracilis  ---actccct-cgcctggaactg------atc
                      D. biarmipes  ---actccct-cgcctggaaccg------atc
                        D. suzukii  ---actccct-cgtctggaaccg------atc
                     D. takahashii  ---actccct-cgcctggaaccg------atc
                        D. elegans  ---actccct-cgcctggaaccg------atc
                       D. rhopaloa  ---actccct-cgcctggaaccg------atc
                         D_serrata  ---actccct-cgaatggaaccgccgatcatc
                       D. kikkawai  ---actccct-cgaatggaaccggcgatcatc
                      D. ananassae  ---acgctct-ggaatggaaccg------atc
                    D. bipectinata  ---acgccct-cgaacggaaccg------atc
                       D_athabasca  ---accccat-c--------------------
                 D_pseudoobscura_1  ---gccccat-c--------------------
                        D. miranda  ---gccccat-c--------------------
                     D. persimilis  ---gccccat-c--------------------
                  D. pseudoobscura  ---gccccat-c--------------------
                      D_subobscura  accaccccat-c--------------------
                         D_obscura  ---accccat-c--------------------
                          D_nasuta  ---gcccccg-c--------------------
                     D. albomicans  ---gcccccg-c--------------------
                     D. willistoni  ================================
                      D. grimshawi  ================================
                        D_arizonae  ================================
                     D. mojavensis  ================================
                        D. virilis  ================================
                    D_novamexicana  ================================
         Proctacanthus_coquilletti  ================================
                 Bactrocera_tryoni  ================================
                Belgica_antarctica  ================================
             Culicoides_sonorensis  ================================
                      A. mellifera  ================================
             Lutzomyia_longipalpis  ================================
                Chironomus_tentans  ================================
                         A_farauti  ================================
               Stomoxys_calcitrans  ================================
                  Bactrocera_oleae  ================================
                Ceratitis_capitata  ================================
                   Lucilia_cuprina  ================================
              Bactrocera_latifrons  ================================
               Bactrocera_dorsalis  ================================
             Zeugodacus_cucurbitae  ================================
                       D_americana  ================================
                      M. domestica  ================================
                           D_hydei  ================================
                Teleopsis_dalmanni  ================================
                Zaprionus_indianus  ================================
     Scaptodrosophila_lebanonensis  ================================
                      T. castaneum  ================================
                         D_montana  ================================

Inserts between block 53 and 54 in window
                     D. ananassae 8bp
                      D_athabasca 5bp
                     D_subobscura 12bp
                        D_obscura 18bp
                         D_nasuta 6bp
                    D. albomicans 6bp

Alignment block 54 of 1353 in window, 827425 - 827447, 23 bps 
B D                D. melanogaster  ---------tt-------c--------------aaccaatacac---------agac-aca---------
  D                    D. simulans  ---------tt-------c--------------aaccaatacgc---------agac-aca---------
B D                   D. sechellia  ---------tt-------c--------------aaccaatacgc---------agac-aca---------
                         D. erecta  ---------tt-------c--------------aaccaatacgc---------agac-aca---------
                         D. yakuba  ---------tt-------c--------------aagcaatacgc---------agac-aca---------
                     D. ficusphila  ---------tt-------c--------------ggccactccag---------aggc-atacaattataa
                     D. eugracilis  ---------tt-------c--------------ggaca------------------c-aca---------
                      D. biarmipes  ---------tt-------c--------------gagcagagcac---------ttgg-aca---------
                        D. suzukii  ---------tt-------c--------------aagcaatacac---------atgg-aca---------
                     D. takahashii  ---------tt-------c--------------aagcaatatac---------acaataca---------
                        D. elegans  ---------tt-------c--------------ggaaa--------------------aca---------
                       D. rhopaloa  ---------tt-------cggcccctctgtggtgggta--------------------aca---------
                         D_serrata  ---------tc-------a--------------ggccact-cactctccagggagtg-caa---------
                       D. kikkawai  ---------tc-------g--------------ggccactccactctccagagagtg-gaa---------
                    D. bipectinata  ---------tc-------c--------------ggtcactcccc---------cgcc-tct---------
                       D_athabasca  cccatcccatc-------c--------------aagca--------------------------------
                 D_pseudoobscura_1  cccatcccatc-------c--------------aagca--------------------------------
                        D. miranda  cccatcccatc-------c--------------aagca--------------------------------
B D                  D. persimilis  cccatcccatc-------c--------------aagca--------------------------------
                  D. pseudoobscura  cccatcccatc-------c--------------aagca--------------------------------
                      D_subobscura  cccatcccagc-------c--------------aagca--------------------------------
                         D_obscura  cccatcccatc-------c--------------aagca--------------------------------
                          D_nasuta  agcatccccttggtggggc--------------agg----------------------------------
                     D. albomicans  agcatccccttggtggggc--------------agg----------------------------------
                    D. willistoni  ======================================================================
                     D. grimshawi  ======================================================================
                     D. ananassae  ======================================================================
                       D_arizonae  ======================================================================
                    D. mojavensis  ======================================================================
                       D. virilis  ======================================================================
                   D_novamexicana  ======================================================================
        Proctacanthus_coquilletti  ======================================================================
                Bactrocera_tryoni  ======================================================================
               Belgica_antarctica  ======================================================================
            Culicoides_sonorensis  ======================================================================
                     A. mellifera  ======================================================================
            Lutzomyia_longipalpis  ======================================================================
               Chironomus_tentans  ======================================================================
                        A_farauti  ======================================================================
              Stomoxys_calcitrans  ======================================================================
                 Bactrocera_oleae  ======================================================================
               Ceratitis_capitata  ======================================================================
                  Lucilia_cuprina  ======================================================================
             Bactrocera_latifrons  ======================================================================
              Bactrocera_dorsalis  ======================================================================
            Zeugodacus_cucurbitae  ======================================================================
                      D_americana  ======================================================================
                     M. domestica  ======================================================================
                          D_hydei  ======================================================================
               Teleopsis_dalmanni  ======================================================================
               Zaprionus_indianus  ======================================================================
    Scaptodrosophila_lebanonensis  ======================================================================
                     T. castaneum  ======================================================================
                        D_montana  ======================================================================

                   D. melanogaster  ---gc
                       D. simulans  ---gc
                      D. sechellia  ---gc
                         D. erecta  ---ac
                         D. yakuba  ---gc
                     D. ficusphila  aacag
                     D. eugracilis  ---at
                      D. biarmipes  -gtgg
                        D. suzukii  -atgg
                     D. takahashii  catag
                        D. elegans  -atgg
                       D. rhopaloa  -atgg
                         D_serrata  ---ga
                       D. kikkawai  ---ga
                    D. bipectinata  -----
                       D_athabasca  -----
                 D_pseudoobscura_1  -----
                        D. miranda  -----
                     D. persimilis  -----
                  D. pseudoobscura  -----
                      D_subobscura  -----
                         D_obscura  -----
                          D_nasuta  -----
                     D. albomicans  -----
                     D. willistoni  =====
                      D. grimshawi  =====
                      D. ananassae  =====
                        D_arizonae  =====
                     D. mojavensis  =====
                        D. virilis  =====
                    D_novamexicana  =====
         Proctacanthus_coquilletti  =====
                 Bactrocera_tryoni  =====
                Belgica_antarctica  =====
             Culicoides_sonorensis  =====
                      A. mellifera  =====
             Lutzomyia_longipalpis  =====
                Chironomus_tentans  =====
                         A_farauti  =====
               Stomoxys_calcitrans  =====
                  Bactrocera_oleae  =====
                Ceratitis_capitata  =====
                   Lucilia_cuprina  =====
              Bactrocera_latifrons  =====
               Bactrocera_dorsalis  =====
             Zeugodacus_cucurbitae  =====
                       D_americana  =====
                      M. domestica  =====
                           D_hydei  =====
                Teleopsis_dalmanni  =====
                Zaprionus_indianus  =====
     Scaptodrosophila_lebanonensis  =====
                      T. castaneum  =====
                         D_montana  =====

Alignment block 55 of 1353 in window, 827448 - 827450, 3 bps 
B D                D. melanogaster  acg
  D                    D. simulans  acg
B D                   D. sechellia  acg
                         D. erecta  cgg
                         D. yakuba  aag
                     D. ficusphila  agg
                     D. eugracilis  tgg
                      D. biarmipes  cgg
                        D. suzukii  agg
                     D. takahashii  agg
                        D. elegans  agg
                       D. rhopaloa  agg
                         D_serrata  aag
                       D. kikkawai  aag
                     D. willistoni  aag
                     D. grimshawi  ===
                     D. ananassae  ===
                       D. miranda  ---
                      D_athabasca  ---
                 D. pseudoobscura  ---
                       D_arizonae  ===
                    D. mojavensis  ===
                       D. virilis  ===
                   D_novamexicana  ===
                    D. albomicans  ---
                         D_nasuta  ---
        Proctacanthus_coquilletti  ===
                Bactrocera_tryoni  ===
               Belgica_antarctica  ===
            Culicoides_sonorensis  ===
                     A. mellifera  ===
            Lutzomyia_longipalpis  ===
               Chironomus_tentans  ===
                        A_farauti  ===
              Stomoxys_calcitrans  ===
                 Bactrocera_oleae  ===
               Ceratitis_capitata  ===
                  Lucilia_cuprina  ===
             Bactrocera_latifrons  ===
              Bactrocera_dorsalis  ===
            Zeugodacus_cucurbitae  ===
                      D_americana  ===
                     M. domestica  ===
                   D. bipectinata  ---
                D_pseudoobscura_1  ---
                        D_obscura  ---
                     D_subobscura  ---
                          D_hydei  ===
B D                  D. persimilis  ---
               Teleopsis_dalmanni  ===
               Zaprionus_indianus  ===
    Scaptodrosophila_lebanonensis  ===
                     T. castaneum  ===
                        D_montana  ===

Alignment block 56 of 1353 in window, 827451 - 827489, 39 bps 
B D                D. melanogaster  ggga------------aacaa-actttccgcctcataaacttgtgggcttgt
  D                    D. simulans  ggga------------aacaa-actttccgcctcataaacttgtgggcttgt
B D                   D. sechellia  ggga------------aacaa-actttccgcctcataaacttgtgggcttgt
                         D. erecta  ggga------------aacaa-actttccgcctcataaacttgtgggcttgt
                         D. yakuba  ggga------------aacaa-actttccgcctcataaacttgtgggcttgt
                     D. ficusphila  ggag------------agaaa-actttccgcctcataaacttgaaggcttgt
                     D. eugracilis  ggga------------agcaatactttccgcctcataaacttatgggcctgt
                      D. biarmipes  ggaa------------gcgaa-actttccgcctcataaactcgtgggcccgc
                        D. suzukii  ggaa------------acaaa-actttccgcctcataaactcgtgggcttgc
                     D. takahashii  ggaa------------acaaa-actttccgcctcataaacctatgggcttgt
                        D. elegans  ggaa------------agaaa-actttccgcctcataaactcataggcttgt
                       D. rhopaloa  gcaa------------agaaa-actttccgcctcataaactcatgggcttgt
                         D_serrata  ggaaataccaaaaagaaagaa-actttccgcctcataaactcgtgggctcgc
                       D. kikkawai  ggaattaccgaaaagcaagaa-actttccgcctcataaactcgtgggcccgt
                    D. bipectinata  ----------------cagaa-agttcccccccttt---cttgggagctttt
                       D_athabasca  --ga------------agaaa-actttccgcctcataaactcgtgggcttgt
                 D_pseudoobscura_1  --ga------------agaaa-actttccgcctcataaactcgtgggcttgt
                        D. miranda  --ga------------agaaa-actttccgcctcataaactcgtgggcttgt
B D                  D. persimilis  --ga------------agaaa-actttccgcctcataaactcgtgggcttgt
                  D. pseudoobscura  --ga------------agaaa-actttccgcctcataaactcgtgggcttgt
                      D_subobscura  --ga------------agaaa-actttccgcctcataaaatcgtgggcttgt
                         D_obscura  --ca------------ag-aa-actttccgcctcataaactcgtggggttgc
                Zaprionus_indianus  -ggg------------aaaca-actttccgcctcataaactcgtg-------
                          D_nasuta  caac------------aaaca-actttccgcctcataaactcgacgactcg-
                     D. albomicans  caac------------aaaca-actttccgcctcataaactcgacgactcg-
                     D. willistoni  agga------------aatca-actttacgcctcataaactttgtgg-----
                     D. grimshawi  ====================================================
                     D. ananassae  ====================================================
                       D_arizonae  ====================================================
                    D. mojavensis  ====================================================
                       D. virilis  ====================================================
                   D_novamexicana  ====================================================
        Proctacanthus_coquilletti  ====================================================
                Bactrocera_tryoni  ====================================================
               Belgica_antarctica  ====================================================
            Culicoides_sonorensis  ====================================================
                     A. mellifera  ====================================================
            Lutzomyia_longipalpis  ====================================================
               Chironomus_tentans  ====================================================
                        A_farauti  ====================================================
              Stomoxys_calcitrans  ====================================================
                 Bactrocera_oleae  ====================================================
               Ceratitis_capitata  ====================================================
                  Lucilia_cuprina  ====================================================
             Bactrocera_latifrons  ====================================================
              Bactrocera_dorsalis  ====================================================
            Zeugodacus_cucurbitae  ====================================================
                      D_americana  ====================================================
                     M. domestica  ====================================================
                          D_hydei  ====================================================
               Teleopsis_dalmanni  ====================================================
    Scaptodrosophila_lebanonensis  ====================================================
                     T. castaneum  ====================================================
                        D_montana  ====================================================

Alignment block 57 of 1353 in window, 827490 - 827490, 1 bps 
B D                D. melanogaster  c
  D                    D. simulans  c
B D                   D. sechellia  c
                         D. erecta  c
                         D. yakuba  c
                     D. ficusphila  c
                     D. eugracilis  c
                      D. biarmipes  c
                        D. suzukii  c
                     D. takahashii  c
                        D. elegans  c
                       D. rhopaloa  c
                         D_serrata  c
                       D. kikkawai  c
                      D. ananassae  c
                    D. bipectinata  c
                       D_athabasca  c
                 D_pseudoobscura_1  c
                        D. miranda  c
B D                  D. persimilis  c
                  D. pseudoobscura  c
                      D_subobscura  c
                         D_obscura  c
                    D. willistoni  -
                     D. grimshawi  =
                       D_arizonae  =
                    D. mojavensis  =
                       D. virilis  =
                   D_novamexicana  =
                    D. albomicans  -
                         D_nasuta  -
        Proctacanthus_coquilletti  =
                Bactrocera_tryoni  =
               Belgica_antarctica  =
            Culicoides_sonorensis  =
                     A. mellifera  =
            Lutzomyia_longipalpis  =
               Chironomus_tentans  =
                        A_farauti  =
              Stomoxys_calcitrans  =
                 Bactrocera_oleae  =
               Ceratitis_capitata  =
                  Lucilia_cuprina  =
             Bactrocera_latifrons  =
              Bactrocera_dorsalis  =
            Zeugodacus_cucurbitae  =
                      D_americana  =
                     M. domestica  =
                          D_hydei  =
               Teleopsis_dalmanni  =
               Zaprionus_indianus  -
    Scaptodrosophila_lebanonensis  =
                     T. castaneum  =
                        D_montana  =

Inserts between block 57 and 58 in window
                     D. biarmipes 4bp
                       D. suzukii 4bp
                    D. takahashii 1bp
                        D_serrata 10bp
                      D. kikkawai 10bp
                   D. bipectinata 14bp
                      D_athabasca 15bp
                D_pseudoobscura_1 27bp
                       D. miranda 21bp
B D                 D. persimilis 27bp
                 D. pseudoobscura 21bp
                     D_subobscura 24bp
                        D_obscura 27bp

Alignment block 58 of 1353 in window, 827491 - 827516, 26 bps 
B D                D. melanogaster  cc-cca--agcacgtgcaactc-----tt----------------tc-------------------ttt
  D                    D. simulans  cc-cca--agcacgtgcaactc-----tt----------------tc-------------------ttt
B D                   D. sechellia  cc-cca--agcacgtgcaactc-----tt----------------tc-------------------ttt
                         D. erecta  cc-cca--agcacgtgcaactc-----tt----------------tc-------------------ttt
                         D. yakuba  cc-cca--agcacgtgcaactc-----tt----------------tc-------------------ttt
                     D. ficusphila  cc-cca--agcacgtgcaactt-----ttttcttcggcgatttcctc-------------------ttt
                     D. eugracilis  tt-cca--agcacgtgcaactc-----tt----------------tc-------------------ttt
                      D. biarmipes  cc-tcgacagcacgtgcagctc-----tt----------------tc--------------------tt
                        D. suzukii  cc-ccaacagcacgtgcaactc-----tt----------------tc-------------------ttt
                     D. takahashii  cc-cgaaaagcacgtgcaactc-----tt----------------tt-----------------tcttt
                        D. elegans  ccgtcg--agcacgtgcaactc-----tt----------------tcatttttcagcacttccctcttt
                       D. rhopaloa  cc-ccg--agcacgtgcaactc-----tt----------------ttattttacggtgcttccatcttt
                         D_serrata  cc-caa--agcacgtgcgactctttgttt----------------tc-------------------ttt
                       D. kikkawai  cc-caa--agcacgtgcaactc-----tt----------------tc-------------------ttt
                      D. ananassae  ct-tcc--agcacgtgcaactc-----tt----------------tc-------------------tct
                       D_athabasca  ct-cc---ggcacgtgcaactc-----tt----------------tc-------------------ttt
                 D_pseudoobscura_1  ct-cca--ggcacgtgcaactc-----tt----------------tc-------------------ttt
                        D. miranda  ct-cca--ggcacgtgcaactc-----tt----------------tc-------------------ttt
B D                  D. persimilis  ct-cca--ggcacgtgcaactc-----tt----------------tc-------------------ttt
                  D. pseudoobscura  ct-cca--ggcacgtgcaactc-----tt----------------tc-------------------ttt
                      D_subobscura  ct--ca--ggcacgtgcaactc-----tt----------------tc-------------------ttt
                         D_obscura  ct--ca--ggcacgtgcaactc-----tt----------------tc-------------------ttt
                Zaprionus_indianus  --------agcacgtgcaactc-----tt----------------tc-------------------aat
                          D_nasuta  --------agcacgtgcaactc-----tt----------------tc-----------------aattt
                     D. albomicans  --------agcacgtgcaactc-----tt----------------tc-----------------aattt
                     D. willistoni  ---------gcacgtgcatttc-----tt----------------tt-------------------cat
                     D. grimshawi  =====================================================================
                       D_arizonae  =====================================================================
                    D. mojavensis  =====================================================================
                       D. virilis  =====================================================================
                   D_novamexicana  =====================================================================
        Proctacanthus_coquilletti  =====================================================================
                Bactrocera_tryoni  =====================================================================
               Belgica_antarctica  =====================================================================
            Culicoides_sonorensis  =====================================================================
                     A. mellifera  =====================================================================
            Lutzomyia_longipalpis  =====================================================================
               Chironomus_tentans  =====================================================================
                        A_farauti  =====================================================================
              Stomoxys_calcitrans  =====================================================================
                 Bactrocera_oleae  =====================================================================
               Ceratitis_capitata  =====================================================================
                  Lucilia_cuprina  =====================================================================
             Bactrocera_latifrons  =====================================================================
              Bactrocera_dorsalis  =====================================================================
            Zeugodacus_cucurbitae  =====================================================================
                      D_americana  =====================================================================
                     M. domestica  =====================================================================
                   D. bipectinata  =====================================================================
                          D_hydei  =====================================================================
               Teleopsis_dalmanni  =====================================================================
    Scaptodrosophila_lebanonensis  =====================================================================
                     T. castaneum  =====================================================================
                        D_montana  =====================================================================

Inserts between block 58 and 59 in window
                     D. ananassae 9bp

Alignment block 59 of 1353 in window, 827517 - 827519, 3 bps 
B D                D. melanogaster  ctc
  D                    D. simulans  ctc
B D                   D. sechellia  ctc
                         D. erecta  ccc
                         D. yakuba  ccc
                     D. ficusphila  ctc
                     D. eugracilis  ctc
                      D. biarmipes  tcc
                        D. suzukii  tcc
                     D. takahashii  ctc
                        D. elegans  ctc
                       D. rhopaloa  ctc
                         D_serrata  ctt
                       D. kikkawai  ctt
                       D_athabasca  ctt
                 D_pseudoobscura_1  ctt
                        D. miranda  ctt
B D                  D. persimilis  ctt
                  D. pseudoobscura  ctt
                      D_subobscura  ctt
                         D_obscura  ctt
                Zaprionus_indianus  ttc
                          D_nasuta  ctc
                     D. albomicans  ctc
                     D. willistoni  ttc
                     D. grimshawi  ===
                     D. ananassae  ===
                       D_arizonae  ===
                    D. mojavensis  ===
                       D. virilis  ===
                   D_novamexicana  ===
        Proctacanthus_coquilletti  ===
                Bactrocera_tryoni  ===
               Belgica_antarctica  ===
            Culicoides_sonorensis  ===
                     A. mellifera  ===
            Lutzomyia_longipalpis  ===
               Chironomus_tentans  ===
                        A_farauti  ===
              Stomoxys_calcitrans  ===
                 Bactrocera_oleae  ===
               Ceratitis_capitata  ===
                  Lucilia_cuprina  ===
             Bactrocera_latifrons  ===
              Bactrocera_dorsalis  ===
            Zeugodacus_cucurbitae  ===
                      D_americana  ===
                     M. domestica  ===
                   D. bipectinata  ===
                          D_hydei  ===
               Teleopsis_dalmanni  ===
    Scaptodrosophila_lebanonensis  ===
                     T. castaneum  ===
                        D_montana  ===

Inserts between block 59 and 60 in window
                    D. willistoni 3377bp

Alignment block 60 of 1353 in window, 827520 - 827520, 1 bps 
B D                D. melanogaster  t
  D                    D. simulans  t
B D                   D. sechellia  t
                         D. erecta  t
                         D. yakuba  t
                     D. ficusphila  t
                     D. eugracilis  t
                      D. biarmipes  c
                        D. suzukii  c
                     D. takahashii  t
                        D. elegans  t
                       D. rhopaloa  t
                         D_serrata  t
                       D. kikkawai  t
                       D_athabasca  t
                 D_pseudoobscura_1  t
                        D. miranda  t
B D                  D. persimilis  t
                  D. pseudoobscura  t
                      D_subobscura  t
                         D_obscura  t
                Zaprionus_indianus  t
                          D_nasuta  t
                     D. albomicans  t
                    D. willistoni  =
                     D. grimshawi  =
                     D. ananassae  =
                       D_arizonae  =
                    D. mojavensis  =
                       D. virilis  =
                   D_novamexicana  =
        Proctacanthus_coquilletti  =
                Bactrocera_tryoni  =
               Belgica_antarctica  =
            Culicoides_sonorensis  =
                     A. mellifera  =
            Lutzomyia_longipalpis  =
               Chironomus_tentans  =
                        A_farauti  =
              Stomoxys_calcitrans  =
                 Bactrocera_oleae  =
               Ceratitis_capitata  =
                  Lucilia_cuprina  =
             Bactrocera_latifrons  =
              Bactrocera_dorsalis  =
            Zeugodacus_cucurbitae  =
                      D_americana  =
                     M. domestica  =
                   D. bipectinata  =
                          D_hydei  =
               Teleopsis_dalmanni  =
    Scaptodrosophila_lebanonensis  =
                     T. castaneum  =
                        D_montana  =

Inserts between block 60 and 61 in window
                        D_serrata 35bp
                      D. kikkawai 1077bp
                      D_athabasca 126bp

Alignment block 61 of 1353 in window, 827521 - 827521, 1 bps 
B D                D. melanogaster  c
  D                    D. simulans  c
B D                   D. sechellia  c
                         D. erecta  c
                         D. yakuba  c
                     D. ficusphila  g
                     D. eugracilis  c
                      D. biarmipes  c
                        D. suzukii  c
                     D. takahashii  c
                        D. elegans  c
                       D. rhopaloa  c
                         D_serrata  c
                 D_pseudoobscura_1  c
                        D. miranda  c
B D                  D. persimilis  c
                  D. pseudoobscura  c
                      D_subobscura  t
                         D_obscura  c
                Zaprionus_indianus  c
                          D_nasuta  t
                     D. albomicans  t
                    D. willistoni  =
                     D. grimshawi  =
                     D. ananassae  =
                      D_athabasca  =
                       D_arizonae  =
                    D. mojavensis  =
                       D. virilis  =
                   D_novamexicana  =
        Proctacanthus_coquilletti  =
                Bactrocera_tryoni  =
               Belgica_antarctica  =
            Culicoides_sonorensis  =
                     A. mellifera  =
            Lutzomyia_longipalpis  =
               Chironomus_tentans  =
                        A_farauti  =
              Stomoxys_calcitrans  =
                 Bactrocera_oleae  =
               Ceratitis_capitata  =
                  Lucilia_cuprina  =
             Bactrocera_latifrons  =
              Bactrocera_dorsalis  =
            Zeugodacus_cucurbitae  =
                      D_americana  =
                     M. domestica  =
                      D. kikkawai  =
                   D. bipectinata  =
                          D_hydei  =
               Teleopsis_dalmanni  =
    Scaptodrosophila_lebanonensis  =
                     T. castaneum  =
                        D_montana  =

Inserts between block 61 and 62 in window
                D_pseudoobscura_1 107bp
                       D. miranda 15bp
B D                 D. persimilis 107bp
                 D. pseudoobscura 103bp
                     D_subobscura 11bp
                        D_obscura 11bp

Alignment block 62 of 1353 in window, 827522 - 827547, 26 bps 
B D                D. melanogaster  agcgaa---aagacg-----aactgctgtcagga
  D                    D. simulans  agcgaa---aagacg-----aactgctgtcagga
B D                   D. sechellia  agcgaa---aagacg-----aactgctgtcagga
                         D. erecta  agcgaa---aagacg-----aactgctgtcaaga
                         D. yakuba  agcgaa---aagacg-----aactgctgtcagga
                     D. ficusphila  aataaa---aagacg-----aaatgttgtcaaga
                     D. eugracilis  agggaa---aagacg-----aaatgttgtcaaga
                      D. biarmipes  gacg-a---aagacg-----gaatgttgtcaaga
                        D. suzukii  gacg-a---aagacg-----aatagttgtcaaga
                     D. takahashii  gtcgaa---aagacg-----aaatgttgtcaaga
                        D. elegans  aa---a---tagacg-----aaatgttgtcaaga
                       D. rhopaloa  aa---a---aagacg-----aaatgttgtcaaga
                         D_serrata  actgaaaacaagacg-----aaatgctgtcaagg
                        D. miranda  --------tctgacgaaataaaatgttgtcaagc
                      D_subobscura  --------tctgacgaaatgaaatgttgtcaagg
                         D_obscura  --------tctgacgaaatgaaatgttgtcaagc
                Zaprionus_indianus  --------tttgacg-----agctgtctccaaag
                          D_nasuta  ----------tgacg-----aactgtctccaaaa
                     D. albomicans  ----------tgacg-----aactgtctccaaaa
                    D. willistoni  ==================================
                     D. grimshawi  ==================================
                     D. ananassae  ==================================
                      D_athabasca  ==================================
                 D. pseudoobscura  ==================================
                       D_arizonae  ==================================
                    D. mojavensis  ==================================
                       D. virilis  ==================================
                   D_novamexicana  ==================================
        Proctacanthus_coquilletti  ==================================
                Bactrocera_tryoni  ==================================
               Belgica_antarctica  ==================================
            Culicoides_sonorensis  ==================================
                     A. mellifera  ==================================
            Lutzomyia_longipalpis  ==================================
               Chironomus_tentans  ==================================
                        A_farauti  ==================================
              Stomoxys_calcitrans  ==================================
                 Bactrocera_oleae  ==================================
               Ceratitis_capitata  ==================================
                  Lucilia_cuprina  ==================================
             Bactrocera_latifrons  ==================================
              Bactrocera_dorsalis  ==================================
            Zeugodacus_cucurbitae  ==================================
                      D_americana  ==================================
                     M. domestica  ==================================
                      D. kikkawai  ==================================
                   D. bipectinata  ==================================
                D_pseudoobscura_1  ==================================
                          D_hydei  ==================================
B D                  D. persimilis  ==================================
               Teleopsis_dalmanni  ==================================
    Scaptodrosophila_lebanonensis  ==================================
                     T. castaneum  ==================================
                        D_montana  ==================================

Inserts between block 62 and 63 in window
                        D_obscura 65bp
                         D_nasuta 2184bp
                    D. albomicans 2280bp

Alignment block 63 of 1353 in window, 827548 - 827550, 3 bps 
B D                D. melanogaster  aaa
  D                    D. simulans  aaa
B D                   D. sechellia  aaa
                         D. erecta  aaa
                         D. yakuba  aaa
                     D. ficusphila  aaa
                     D. eugracilis  aa-
                      D. biarmipes  aaa
                        D. suzukii  aaa
                     D. takahashii  aaa
                        D. elegans  aaa
                       D. rhopaloa  aaa
                         D_serrata  caa
                    D. willistoni  ===
                     D. grimshawi  ===
                     D. ananassae  ===
                       D. miranda  ---
                      D_athabasca  ===
                 D. pseudoobscura  ===
                       D_arizonae  ===
                    D. mojavensis  ===
                       D. virilis  ===
                   D_novamexicana  ===
                    D. albomicans  ===
                         D_nasuta  ===
        Proctacanthus_coquilletti  ===
                Bactrocera_tryoni  ===
               Belgica_antarctica  ===
            Culicoides_sonorensis  ===
                     A. mellifera  ===
            Lutzomyia_longipalpis  ===
               Chironomus_tentans  ===
                        A_farauti  ===
              Stomoxys_calcitrans  ===
                 Bactrocera_oleae  ===
               Ceratitis_capitata  ===
                  Lucilia_cuprina  ===
             Bactrocera_latifrons  ===
              Bactrocera_dorsalis  ===
            Zeugodacus_cucurbitae  ===
                      D_americana  ===
                     M. domestica  ===
                      D. kikkawai  ===
                   D. bipectinata  ===
                D_pseudoobscura_1  ===
                        D_obscura  ===
                     D_subobscura  ---
                          D_hydei  ===
B D                  D. persimilis  ===
               Teleopsis_dalmanni  ===
               Zaprionus_indianus  ---
    Scaptodrosophila_lebanonensis  ===
                     T. castaneum  ===
                        D_montana  ===

Alignment block 64 of 1353 in window, 827551 - 827556, 6 bps 
B D                D. melanogaster  caatga
  D                    D. simulans  caatga
B D                   D. sechellia  caatga
                         D. erecta  caatga
                         D. yakuba  caatga
                     D. ficusphila  caatgt
                     D. eugracilis  -aatta
                      D. biarmipes  caatga
                        D. suzukii  caatga
                     D. takahashii  caatga
                        D. elegans  caataa
                       D. rhopaloa  caataa
                         D_serrata  tggcac
                        D. miranda  caatgg
                      D_subobscura  caatgg
                Zaprionus_indianus  cagaga
                    D. willistoni  ======
                     D. grimshawi  ======
                     D. ananassae  ======
                      D_athabasca  ======
                 D. pseudoobscura  ======
                       D_arizonae  ======
                    D. mojavensis  ======
                       D. virilis  ======
                   D_novamexicana  ======
                    D. albomicans  ======
                         D_nasuta  ======
        Proctacanthus_coquilletti  ======
                Bactrocera_tryoni  ======
               Belgica_antarctica  ======
            Culicoides_sonorensis  ======
                     A. mellifera  ======
            Lutzomyia_longipalpis  ======
               Chironomus_tentans  ======
                        A_farauti  ======
              Stomoxys_calcitrans  ======
                 Bactrocera_oleae  ======
               Ceratitis_capitata  ======
                  Lucilia_cuprina  ======
             Bactrocera_latifrons  ======
              Bactrocera_dorsalis  ======
            Zeugodacus_cucurbitae  ======
                      D_americana  ======
                     M. domestica  ======
                      D. kikkawai  ======
                   D. bipectinata  ======
                D_pseudoobscura_1  ======
                        D_obscura  ======
                          D_hydei  ======
B D                  D. persimilis  ======
               Teleopsis_dalmanni  ======
    Scaptodrosophila_lebanonensis  ======
                     T. castaneum  ======
                        D_montana  ======

Inserts between block 64 and 65 in window
               Zaprionus_indianus 2314bp

Alignment block 65 of 1353 in window, 827557 - 827558, 2 bps 
B D                D. melanogaster  ac
  D                    D. simulans  gc
B D                   D. sechellia  ac
                         D. erecta  gc
                         D. yakuba  gc
                     D. ficusphila  ag
                     D. eugracilis  ac
                      D. biarmipes  a-
                        D. suzukii  ac
                     D. takahashii  ac
                        D. elegans  ac
                       D. rhopaloa  ac
                         D_serrata  a-
                        D. miranda  ac
                      D_subobscura  gc
                    D. willistoni  ==
                     D. grimshawi  ==
                     D. ananassae  ==
                      D_athabasca  ==
                 D. pseudoobscura  ==
                       D_arizonae  ==
                    D. mojavensis  ==
                       D. virilis  ==
                   D_novamexicana  ==
                    D. albomicans  ==
                         D_nasuta  ==
        Proctacanthus_coquilletti  ==
                Bactrocera_tryoni  ==
               Belgica_antarctica  ==
            Culicoides_sonorensis  ==
                     A. mellifera  ==
            Lutzomyia_longipalpis  ==
               Chironomus_tentans  ==
                        A_farauti  ==
              Stomoxys_calcitrans  ==
                 Bactrocera_oleae  ==
               Ceratitis_capitata  ==
                  Lucilia_cuprina  ==
             Bactrocera_latifrons  ==
              Bactrocera_dorsalis  ==
            Zeugodacus_cucurbitae  ==
                      D_americana  ==
                     M. domestica  ==
                      D. kikkawai  ==
                   D. bipectinata  ==
                D_pseudoobscura_1  ==
                        D_obscura  ==
                          D_hydei  ==
B D                  D. persimilis  ==
               Teleopsis_dalmanni  ==
               Zaprionus_indianus  ==
    Scaptodrosophila_lebanonensis  ==
                     T. castaneum  ==
                        D_montana  ==

Inserts between block 65 and 66 in window
                       D. miranda 50bp

Alignment block 66 of 1353 in window, 827559 - 827571, 13 bps 
B D                D. melanogaster  gagtgcaccggaa
  D                    D. simulans  gagtgcaccgg-a
B D                   D. sechellia  gagtgcactgg--
                         D. erecta  gagtgcacggg-a
                         D. yakuba  gagtgcacgga-a
                     D. ficusphila  gagtgcacaca-a
                     D. eugracilis  gagtgcacagcga
                      D. biarmipes  cagtgcacagc-a
                        D. suzukii  cagtgcacagc-g
                     D. takahashii  cagtgcacagg-a
                        D. elegans  gaatgcacaga-a
                       D. rhopaloa  gagtgcac-gg-g
                         D_serrata  aagtacactgc-a
                      D_subobscura  ------atgga-t
                    D. willistoni  =============
                     D. grimshawi  =============
                     D. ananassae  =============
                       D. miranda  =============
                      D_athabasca  =============
                 D. pseudoobscura  =============
                       D_arizonae  =============
                    D. mojavensis  =============
                       D. virilis  =============
                   D_novamexicana  =============
                    D. albomicans  =============
                         D_nasuta  =============
        Proctacanthus_coquilletti  =============
                Bactrocera_tryoni  =============
               Belgica_antarctica  =============
            Culicoides_sonorensis  =============
                     A. mellifera  =============
            Lutzomyia_longipalpis  =============
               Chironomus_tentans  =============
                        A_farauti  =============
              Stomoxys_calcitrans  =============
                 Bactrocera_oleae  =============
               Ceratitis_capitata  =============
                  Lucilia_cuprina  =============
             Bactrocera_latifrons  =============
              Bactrocera_dorsalis  =============
            Zeugodacus_cucurbitae  =============
                      D_americana  =============
                     M. domestica  =============
                      D. kikkawai  =============
                   D. bipectinata  =============
                D_pseudoobscura_1  =============
                        D_obscura  =============
                          D_hydei  =============
B D                  D. persimilis  =============
               Teleopsis_dalmanni  =============
               Zaprionus_indianus  =============
    Scaptodrosophila_lebanonensis  =============
                     T. castaneum  =============
                        D_montana  =============

Alignment block 67 of 1353 in window, 827572 - 827580, 9 bps 
B D                D. melanogaster  aaaaa-cata
  D                    D. simulans  aaaaa-cata
B D                   D. sechellia  aaaaa-cata
                         D. erecta  aaaaa-cata
                         D. yakuba  aaaaa-tata
                     D. ficusphila  aaaaa-tatg
                     D. eugracilis  aaaaa-aaca
                      D. biarmipes  agaaa-catc
                        D. suzukii  aaaaa-catc
                     D. takahashii  aaaaa-catc
                        D. elegans  aaaaa-tatc
                       D. rhopaloa  aaaaa-tata
                         D_serrata  ggaaattata
                      D_subobscura  atgga-tatg
                      A_epiroticus  aagaa-taaa
                    D. willistoni  ==========
                     D. grimshawi  ==========
                     D. ananassae  ==========
                       D. miranda  ==========
                      D_athabasca  ==========
                 D. pseudoobscura  ==========
                       D_arizonae  ==========
                    D. mojavensis  ==========
                       D. virilis  ==========
                   D_novamexicana  ==========
                    D. albomicans  ==========
                         D_nasuta  ==========
        Proctacanthus_coquilletti  ==========
                Bactrocera_tryoni  ==========
               Belgica_antarctica  ==========
            Culicoides_sonorensis  ==========
                     A. mellifera  ==========
            Lutzomyia_longipalpis  ==========
               Chironomus_tentans  ==========
                        A_farauti  ==========
              Stomoxys_calcitrans  ==========
                 Bactrocera_oleae  ==========
               Ceratitis_capitata  ==========
                  Lucilia_cuprina  ==========
             Bactrocera_latifrons  ==========
              Bactrocera_dorsalis  ==========
            Zeugodacus_cucurbitae  ==========
                      D_americana  ==========
                     M. domestica  ==========
                      D. kikkawai  ==========
                   D. bipectinata  ==========
                D_pseudoobscura_1  ==========
                        D_obscura  ==========
                          D_hydei  ==========
B D                  D. persimilis  ==========
               Teleopsis_dalmanni  ==========
               Zaprionus_indianus  ==========
    Scaptodrosophila_lebanonensis  ==========
                     T. castaneum  ==========
                        D_montana  ==========

Inserts between block 67 and 68 in window
                        D_serrata 696bp
                     D_subobscura 4bp

Alignment block 68 of 1353 in window, 827581 - 827587, 7 bps 
B D                D. melanogaster  aat----gt----------tt-
  D                    D. simulans  tat----gt----------tt-
B D                   D. sechellia  tat----gt----------tt-
                         D. erecta  ta------------------t-
                         D. yakuba  ta------------------t-
                     D. ficusphila  tac----atgttattaaagcc-
                     D. eugracilis  -------------------tc-
                      D. biarmipes  gatacct---------------
                        D. suzukii  gacacta---------------
                     D. takahashii  gatacca---------------
                        D. elegans  ttt-------------------
                       D. rhopaloa  ttt-------------------
                      D_subobscura  gat-------------------
                      A_epiroticus  ---------------aaagttg
                    D. willistoni  ======================
                     D. grimshawi  ======================
                     D. ananassae  ======================
                       D. miranda  ======================
                      D_athabasca  ======================
                 D. pseudoobscura  ======================
                       D_arizonae  ======================
                    D. mojavensis  ======================
                       D. virilis  ======================
                   D_novamexicana  ======================
                    D. albomicans  ======================
                         D_nasuta  ======================
        Proctacanthus_coquilletti  ======================
                Bactrocera_tryoni  ======================
               Belgica_antarctica  ======================
            Culicoides_sonorensis  ======================
                     A. mellifera  ======================
            Lutzomyia_longipalpis  ======================
               Chironomus_tentans  ======================
                        A_farauti  ======================
              Stomoxys_calcitrans  ======================
                 Bactrocera_oleae  ======================
               Ceratitis_capitata  ======================
                  Lucilia_cuprina  ======================
             Bactrocera_latifrons  ======================
              Bactrocera_dorsalis  ======================
            Zeugodacus_cucurbitae  ======================
                      D_americana  ======================
                     M. domestica  ======================
                      D. kikkawai  ======================
                   D. bipectinata  ======================
                D_pseudoobscura_1  ======================
                        D_obscura  ======================
                          D_hydei  ======================
B D                  D. persimilis  ======================
               Teleopsis_dalmanni  ======================
               Zaprionus_indianus  ======================
    Scaptodrosophila_lebanonensis  ======================
                     T. castaneum  ======================
                        D_serrata  ======================
                        D_montana  ======================

Inserts between block 68 and 69 in window
                     D. biarmipes 482bp
                       D. suzukii 12bp
                    D. takahashii 15bp
                     D_subobscura 1bp

Alignment block 69 of 1353 in window, 827588 - 827596, 9 bps 
B D                D. melanogaster  ---gtcatacgg
  D                    D. simulans  ---gtcatacgg
B D                   D. sechellia  ---gtcatacgg
                         D. erecta  ---gtcatacag
                         D. yakuba  ---gtcatgcag
                     D. ficusphila  ---atcata-ac
                     D. eugracilis  ---gtaatatg-
                        D. suzukii  ---ataacacat
                     D. takahashii  ---gtaatacta
                        D. elegans  ---tgaatgcag
                       D. rhopaloa  ---tccatacag
                      D_subobscura  ---gttgg----
                      A_epiroticus  ttcactaga---
                    D. willistoni  ============
                     D. grimshawi  ============
                     D. ananassae  ============
                       D. miranda  ============
                      D_athabasca  ============
                 D. pseudoobscura  ============
                     D. biarmipes  ============
                       D_arizonae  ============
                    D. mojavensis  ============
                       D. virilis  ============
                   D_novamexicana  ============
                    D. albomicans  ============
                         D_nasuta  ============
        Proctacanthus_coquilletti  ============
                Bactrocera_tryoni  ============
               Belgica_antarctica  ============
            Culicoides_sonorensis  ============
                     A. mellifera  ============
            Lutzomyia_longipalpis  ============
               Chironomus_tentans  ============
                        A_farauti  ============
              Stomoxys_calcitrans  ============
                 Bactrocera_oleae  ============
               Ceratitis_capitata  ============
                  Lucilia_cuprina  ============
             Bactrocera_latifrons  ============
              Bactrocera_dorsalis  ============
            Zeugodacus_cucurbitae  ============
                      D_americana  ============
                     M. domestica  ============
                      D. kikkawai  ============
                   D. bipectinata  ============
                D_pseudoobscura_1  ============
                        D_obscura  ============
                          D_hydei  ============
B D                  D. persimilis  ============
               Teleopsis_dalmanni  ============
               Zaprionus_indianus  ============
    Scaptodrosophila_lebanonensis  ============
                     T. castaneum  ============
                        D_serrata  ============
                        D_montana  ============

Inserts between block 69 and 70 in window
                       D. suzukii 52bp
                    D. takahashii 1417bp
                       D. elegans 39bp
                      D. rhopaloa 60bp

Alignment block 70 of 1353 in window, 827597 - 827678, 82 bps 
B D                D. melanogaster  gaagc--------taagaaatca-----taccaca--aagaattctt-----------------------
  D                    D. simulans  gaagc--------taagaaatca-----taccacattaatcattctt-----------------------
B D                   D. sechellia  gaagc--------taagaaatca-----taccacattggtcattctt-----------------------
                         D. erecta  gaatc--------taacaaatca-----tgacacattagtcatgtttaca-gcagaaatcatatcactca
                         D. yakuba  gaagc--------taacaaatca-----taccacattagtcatgtttacaggcagaaatcatatgactcc
                     D. ficusphila  aatgc--------tgataaataa-----attaatataatttgtttgt-----------------------
                     D. eugracilis  --------------aaaaaatcc-----tatcatatgagtaataagt------------tgtattaatca
                        D. suzukii  ggagt--------tcctaaaaaagcaaatgtataaatatatatattt-----------------------
                     D. takahashii  aagac--------ttataaaaaa--------------------agtt-----------------------
                        D. elegans  agttt--------ctgtaaacag-----caatggaatgtttaaagtt-----------------------
                       D. rhopaloa  agttt--------ttgtttcaaa-----caacggaatgcttatagat-----------------------
                      D_subobscura  ----------------------------------------------------------------------
                      A_epiroticus  gttgccctctttataaaaataaa-----taccaaaagacttgtcga------------------------
                    D. willistoni  ======================================================================
                     D. grimshawi  ======================================================================
                     D. ananassae  ======================================================================
                       D. miranda  ======================================================================
                      D_athabasca  ======================================================================
                 D. pseudoobscura  ======================================================================
                     D. biarmipes  ======================================================================
                       D_arizonae  ======================================================================
                    D. mojavensis  ======================================================================
                       D. virilis  ======================================================================
                   D_novamexicana  ======================================================================
                    D. albomicans  ======================================================================
                         D_nasuta  ======================================================================
        Proctacanthus_coquilletti  ======================================================================
                Bactrocera_tryoni  ======================================================================
               Belgica_antarctica  ======================================================================
            Culicoides_sonorensis  ======================================================================
                     A. mellifera  ======================================================================
            Lutzomyia_longipalpis  ======================================================================
               Chironomus_tentans  ======================================================================
                        A_farauti  ======================================================================
              Stomoxys_calcitrans  ======================================================================
                 Bactrocera_oleae  ======================================================================
               Ceratitis_capitata  ======================================================================
                  Lucilia_cuprina  ======================================================================
             Bactrocera_latifrons  ======================================================================
              Bactrocera_dorsalis  ======================================================================
            Zeugodacus_cucurbitae  ======================================================================
                      D_americana  ======================================================================
                     M. domestica  ======================================================================
                      D. kikkawai  ======================================================================
                   D. bipectinata  ======================================================================
                D_pseudoobscura_1  ======================================================================
                        D_obscura  ======================================================================
                          D_hydei  ======================================================================
B D                  D. persimilis  ======================================================================
               Teleopsis_dalmanni  ======================================================================
               Zaprionus_indianus  ======================================================================
    Scaptodrosophila_lebanonensis  ======================================================================
                     T. castaneum  ======================================================================
                        D_serrata  ======================================================================
                        D_montana  ======================================================================

                   D. melanogaster  ----------------------------t--aa---aa-----ata------------ta----------
                       D. simulans  ----------------------------taaaa---aa-----ata------------ta----------
                      D. sechellia  ----------------------------t--aa---aa-----ata------------ta----------
                         D. erecta  ---cagttggcaaagtcagtggaattcct--aa---aa-----atatacatatgtatgta----------
                         D. yakuba  ---cagttggaaactcagtggaattctta--aa---aa-----ata------------ga----------
                     D. ficusphila  ----------------------------c--aaagtaa-----ata------------taaatcaggaga
                     D. eugracilis  tcgtagttgtt-----------------a--aa---ta-----att------------ta----------
                        D. suzukii  -------------------------------ca---tacttttttc------------tg----------
                     D. takahashii  -------------------------------ca---aa-----ttc------------tt----------
                        D. elegans  -------------------------------aa---aa-----ata------------ta----------
                       D. rhopaloa  -------------------------------aa---aa-----atg------------ca----------
                      D_subobscura  ----------------------------------gtag-----ttg------------gc----------
                      A_epiroticus  -------------------------------aa---ca-----acc------------tc----------
                     D. willistoni  ======================================================================
                      D. grimshawi  ======================================================================
                      D. ananassae  ======================================================================
                        D. miranda  ======================================================================
                       D_athabasca  ======================================================================
                  D. pseudoobscura  ======================================================================
                      D. biarmipes  ======================================================================
                        D_arizonae  ======================================================================
                     D. mojavensis  ======================================================================
                        D. virilis  ======================================================================
                    D_novamexicana  ======================================================================
                     D. albomicans  ======================================================================
                          D_nasuta  ======================================================================
         Proctacanthus_coquilletti  ======================================================================
                 Bactrocera_tryoni  ======================================================================
                Belgica_antarctica  ======================================================================
             Culicoides_sonorensis  ======================================================================
                      A. mellifera  ======================================================================
             Lutzomyia_longipalpis  ======================================================================
                Chironomus_tentans  ======================================================================
                         A_farauti  ======================================================================
               Stomoxys_calcitrans  ======================================================================
                  Bactrocera_oleae  ======================================================================
                Ceratitis_capitata  ======================================================================
                   Lucilia_cuprina  ======================================================================
              Bactrocera_latifrons  ======================================================================
               Bactrocera_dorsalis  ======================================================================
             Zeugodacus_cucurbitae  ======================================================================
                       D_americana  ======================================================================
                      M. domestica  ======================================================================
                       D. kikkawai  ======================================================================
                    D. bipectinata  ======================================================================
                 D_pseudoobscura_1  ======================================================================
                         D_obscura  ======================================================================
                           D_hydei  ======================================================================
                     D. persimilis  ======================================================================
                Teleopsis_dalmanni  ======================================================================
                Zaprionus_indianus  ======================================================================
     Scaptodrosophila_lebanonensis  ======================================================================
                      T. castaneum  ======================================================================
                         D_serrata  ======================================================================
                         D_montana  ======================================================================

                   D. melanogaster  ---tattcattta---------------ttgca------------gtagcagt--agg-----g------
                       D. simulans  ---tattcatttc---------------ttgca------------atagcatt--aat-----g------
                      D. sechellia  ---tattcatttc---------------ttgca------------gtagcatt--agt-----g------
                         D. erecta  ---tattcctttattccctgtaatgttgttgca------------ccaacagt--agt-----g------
                         D. yakuba  ---taatcttgtttttcccctaatgttgttgca------------cccacagt--tgt-----g------
                     D. ficusphila  acctaatctttag---------------ttgta------------tacttgtt--agtttcaaa------
                     D. eugracilis  ---tatttttcaaagttttatcaagtgcttatat-----------atactatt--tgc-----gaagcat
                        D. suzukii  ---aagttcttta---------------cgtaatatttcttgataacagcatcataat-----t------
                     D. takahashii  ---aagatgttta---------------atccaatcagattaatattagaaatctaaa-----a------
                        D. elegans  ---acaatgttta---------------tttcat-----------atcagaatcagac-----t------
                       D. rhopaloa  ---gcaatactaa---------------ttccat-----------ttgacaatcaacc-----c------
                      D_subobscura  ---tggttgtttg---------------gtggatgtg--------cccgtaga--tgg-----g------
                      A_epiroticus  ---gcaaaaccaa---------------tcacg------------gcaacagt--agt-----g------
                     D. willistoni  ======================================================================
                      D. grimshawi  ======================================================================
                      D. ananassae  ======================================================================
                        D. miranda  ======================================================================
                       D_athabasca  ======================================================================
                  D. pseudoobscura  ======================================================================
                      D. biarmipes  ======================================================================
                        D_arizonae  ======================================================================
                     D. mojavensis  ======================================================================
                        D. virilis  ======================================================================
                    D_novamexicana  ======================================================================
                     D. albomicans  ======================================================================
                          D_nasuta  ======================================================================
         Proctacanthus_coquilletti  ======================================================================
                 Bactrocera_tryoni  ======================================================================
                Belgica_antarctica  ======================================================================
             Culicoides_sonorensis  ======================================================================
                      A. mellifera  ======================================================================
             Lutzomyia_longipalpis  ======================================================================
                Chironomus_tentans  ======================================================================
                         A_farauti  ======================================================================
               Stomoxys_calcitrans  ======================================================================
                  Bactrocera_oleae  ======================================================================
                Ceratitis_capitata  ======================================================================
                   Lucilia_cuprina  ======================================================================
              Bactrocera_latifrons  ======================================================================
               Bactrocera_dorsalis  ======================================================================
             Zeugodacus_cucurbitae  ======================================================================
                       D_americana  ======================================================================
                      M. domestica  ======================================================================
                       D. kikkawai  ======================================================================
                    D. bipectinata  ======================================================================
                 D_pseudoobscura_1  ======================================================================
                         D_obscura  ======================================================================
                           D_hydei  ======================================================================
                     D. persimilis  ======================================================================
                Teleopsis_dalmanni  ======================================================================
                Zaprionus_indianus  ======================================================================
     Scaptodrosophila_lebanonensis  ======================================================================
                      T. castaneum  ======================================================================
                         D_serrata  ======================================================================
                         D_montana  ======================================================================

                   D. melanogaster  ---aatcttatca----aat
                       D. simulans  ---aatcttatga----aat
                      D. sechellia  ---aatcttataa----aat
                         D. erecta  ---aatcttatcg----gat
                         D. yakuba  ---aatcttatcg----gat
                     D. ficusphila  ---aatatgataa----aag
                     D. eugracilis  cataatcttatca----acc
                        D. suzukii  ---aatcttatca----ggt
                     D. takahashii  ---aaataca-ca----aat
                        D. elegans  ---taacttatcagtttaat
                       D. rhopaloa  ---aatcttatcactttagc
                      D_subobscura  ---aatgtggctatgtcaat
                      A_epiroticus  ---aagcttatcg----aat
                     D. willistoni  ====================
                      D. grimshawi  ====================
                      D. ananassae  ====================
                        D. miranda  ====================
                       D_athabasca  ====================
                  D. pseudoobscura  ====================
                      D. biarmipes  ====================
                        D_arizonae  ====================
                     D. mojavensis  ====================
                        D. virilis  ====================
                    D_novamexicana  ====================
                     D. albomicans  ====================
                          D_nasuta  ====================
         Proctacanthus_coquilletti  ====================
                 Bactrocera_tryoni  ====================
                Belgica_antarctica  ====================
             Culicoides_sonorensis  ====================
                      A. mellifera  ====================
             Lutzomyia_longipalpis  ====================
                Chironomus_tentans  ====================
                         A_farauti  ====================
               Stomoxys_calcitrans  ====================
                  Bactrocera_oleae  ====================
                Ceratitis_capitata  ====================
                   Lucilia_cuprina  ====================
              Bactrocera_latifrons  ====================
               Bactrocera_dorsalis  ====================
             Zeugodacus_cucurbitae  ====================
                       D_americana  ====================
                      M. domestica  ====================
                       D. kikkawai  ====================
                    D. bipectinata  ====================
                 D_pseudoobscura_1  ====================
                         D_obscura  ====================
                           D_hydei  ====================
                     D. persimilis  ====================
                Teleopsis_dalmanni  ====================
                Zaprionus_indianus  ====================
     Scaptodrosophila_lebanonensis  ====================
                      T. castaneum  ====================
                         D_serrata  ====================
                         D_montana  ====================

Inserts between block 70 and 71 in window
                     D_subobscura 1bp

Alignment block 71 of 1353 in window, 827679 - 827688, 10 bps 
B D                D. melanogaster  cat-------agttca------------------------------------------------------
  D                    D. simulans  tat----tcaagttca------------------------------------------------------
B D                   D. sechellia  tat----tcaagttca------------------------------------------------------
                         D. erecta  agt-------agcaca------------------------------------------------------
                         D. yakuba  tat----tcaagttcatatcttagtaa------------------------------------------t
                     D. ficusphila  aaa-------agtcta------------------------------------------------------
                     D. eugracilis  tagt---tcaagttcaaacttaagaaaaccatatgatcttttaaaagatatcccgataagaccgaagttt
                        D. suzukii  tcc-------agttcat-----------------------------------------------------
                     D. takahashii  tct-------------------------------------------------------------------
                        D. elegans  tca-------agttcat-----------------------------------------------------
                       D. rhopaloa  tca-------agttcat-----------------------------------------------------
                      D. ananassae  ---c---ataatttct------------------------------------------------------
                      D_subobscura  ---t---cttggctgt------------------------------------------------------
                      A_epiroticus  ---cacatttaat---------------------------------------------------------
                    D. willistoni  ======================================================================
                     D. grimshawi  ======================================================================
                       D. miranda  ======================================================================
                      D_athabasca  ======================================================================
                 D. pseudoobscura  ======================================================================
                     D. biarmipes  ======================================================================
                       D_arizonae  ======================================================================
                    D. mojavensis  ======================================================================
                       D. virilis  ======================================================================
                   D_novamexicana  ======================================================================
                    D. albomicans  ======================================================================
                         D_nasuta  ======================================================================
        Proctacanthus_coquilletti  ======================================================================
                Bactrocera_tryoni  ======================================================================
               Belgica_antarctica  ======================================================================
            Culicoides_sonorensis  ======================================================================
                     A. mellifera  ======================================================================
            Lutzomyia_longipalpis  ======================================================================
               Chironomus_tentans  ======================================================================
                        A_farauti  ======================================================================
              Stomoxys_calcitrans  ======================================================================
                 Bactrocera_oleae  ======================================================================
               Ceratitis_capitata  ======================================================================
                  Lucilia_cuprina  ======================================================================
             Bactrocera_latifrons  ======================================================================
              Bactrocera_dorsalis  ======================================================================
            Zeugodacus_cucurbitae  ======================================================================
                      D_americana  ======================================================================
                     M. domestica  ======================================================================
                      D. kikkawai  ======================================================================
                   D. bipectinata  ======================================================================
                D_pseudoobscura_1  ======================================================================
                        D_obscura  ======================================================================
                          D_hydei  ======================================================================
B D                  D. persimilis  ======================================================================
               Teleopsis_dalmanni  ======================================================================
               Zaprionus_indianus  ======================================================================
    Scaptodrosophila_lebanonensis  ======================================================================
                     T. castaneum  ======================================================================
                        D_serrata  ======================================================================
                        D_montana  ======================================================================

                   D. melanogaster  ------t
                       D. simulans  ------t
                      D. sechellia  ------t
                         D. erecta  ----cgt
                         D. yakuba  agcacac
                     D. ficusphila  atgccat
                     D. eugracilis  attgcca
                        D. suzukii  -------
                     D. takahashii  -------
                        D. elegans  -------
                       D. rhopaloa  -------
                      D. ananassae  -------
                      D_subobscura  -------
                      A_epiroticus  -------
                     D. willistoni  =======
                      D. grimshawi  =======
                        D. miranda  =======
                       D_athabasca  =======
                  D. pseudoobscura  =======
                      D. biarmipes  =======
                        D_arizonae  =======
                     D. mojavensis  =======
                        D. virilis  =======
                    D_novamexicana  =======
                     D. albomicans  =======
                          D_nasuta  =======
         Proctacanthus_coquilletti  =======
                 Bactrocera_tryoni  =======
                Belgica_antarctica  =======
             Culicoides_sonorensis  =======
                      A. mellifera  =======
             Lutzomyia_longipalpis  =======
                Chironomus_tentans  =======
                         A_farauti  =======
               Stomoxys_calcitrans  =======
                  Bactrocera_oleae  =======
                Ceratitis_capitata  =======
                   Lucilia_cuprina  =======
              Bactrocera_latifrons  =======
               Bactrocera_dorsalis  =======
             Zeugodacus_cucurbitae  =======
                       D_americana  =======
                      M. domestica  =======
                       D. kikkawai  =======
                    D. bipectinata  =======
                 D_pseudoobscura_1  =======
                         D_obscura  =======
                           D_hydei  =======
                     D. persimilis  =======
                Teleopsis_dalmanni  =======
                Zaprionus_indianus  =======
     Scaptodrosophila_lebanonensis  =======
                      T. castaneum  =======
                         D_serrata  =======
                         D_montana  =======

Inserts between block 71 and 72 in window
                       D. suzukii 332bp
                       D. elegans 11bp
                      D. rhopaloa 11bp

Alignment block 72 of 1353 in window, 827689 - 827689, 1 bps 
B D                D. melanogaster  a
  D                    D. simulans  a
B D                   D. sechellia  a
                         D. erecta  a
                         D. yakuba  a
                     D. ficusphila  c
                     D. eugracilis  a
                        D. suzukii  a
                     D. takahashii  a
                        D. elegans  a
                       D. rhopaloa  a
                      D. ananassae  a
                      D_subobscura  g
                      A_epiroticus  a
                    D. willistoni  =
                     D. grimshawi  =
                       D. miranda  =
                      D_athabasca  =
                 D. pseudoobscura  =
                     D. biarmipes  =
                       D_arizonae  =
                    D. mojavensis  =
                       D. virilis  =
                   D_novamexicana  =
                    D. albomicans  =
                         D_nasuta  =
        Proctacanthus_coquilletti  =
                Bactrocera_tryoni  =
               Belgica_antarctica  =
            Culicoides_sonorensis  =
                     A. mellifera  =
            Lutzomyia_longipalpis  =
               Chironomus_tentans  =
                        A_farauti  =
              Stomoxys_calcitrans  =
                 Bactrocera_oleae  =
               Ceratitis_capitata  =
                  Lucilia_cuprina  =
             Bactrocera_latifrons  =
              Bactrocera_dorsalis  =
            Zeugodacus_cucurbitae  =
                      D_americana  =
                     M. domestica  =
                      D. kikkawai  =
                   D. bipectinata  =
                D_pseudoobscura_1  =
                        D_obscura  =
                          D_hydei  =
B D                  D. persimilis  =
               Teleopsis_dalmanni  =
               Zaprionus_indianus  =
    Scaptodrosophila_lebanonensis  =
                     T. castaneum  =
                        D_serrata  =
                        D_montana  =

Alignment block 73 of 1353 in window, 827690 - 827696, 7 bps 
B D                D. melanogaster  atatatt
  D                    D. simulans  taacatt
B D                   D. sechellia  ttaaatt
                         D. erecta  ttatgtt
                         D. yakuba  ttatgtt
                     D. ficusphila  tgatatt
                     D. eugracilis  ctaaatt
                        D. suzukii  acctatt
                     D. takahashii  aaataat
                        D. elegans  acatatg
                       D. rhopaloa  acatatg
                    D. bipectinata  acatatt
                      D_subobscura  --gcact
                      A_epiroticus  acataca
                    D. willistoni  =======
                     D. grimshawi  =======
                     D. ananassae  -------
                       D. miranda  =======
                      D_athabasca  =======
                 D. pseudoobscura  =======
                     D. biarmipes  =======
                       D_arizonae  =======
                    D. mojavensis  =======
                       D. virilis  =======
                   D_novamexicana  =======
                    D. albomicans  =======
                         D_nasuta  =======
        Proctacanthus_coquilletti  =======
                Bactrocera_tryoni  =======
               Belgica_antarctica  =======
            Culicoides_sonorensis  =======
                     A. mellifera  =======
            Lutzomyia_longipalpis  =======
               Chironomus_tentans  =======
                        A_farauti  =======
              Stomoxys_calcitrans  =======
                 Bactrocera_oleae  =======
               Ceratitis_capitata  =======
                  Lucilia_cuprina  =======
             Bactrocera_latifrons  =======
              Bactrocera_dorsalis  =======
            Zeugodacus_cucurbitae  =======
                      D_americana  =======
                     M. domestica  =======
                      D. kikkawai  =======
                D_pseudoobscura_1  =======
                        D_obscura  =======
                          D_hydei  =======
B D                  D. persimilis  =======
               Teleopsis_dalmanni  =======
               Zaprionus_indianus  =======
    Scaptodrosophila_lebanonensis  =======
                     T. castaneum  =======
                        D_serrata  =======
                        D_montana  =======

Inserts between block 73 and 74 in window
                       D. suzukii 1bp
                       D. elegans 46bp
                      D. rhopaloa 53bp
                     D_subobscura 2bp

Alignment block 74 of 1353 in window, 827697 - 827761, 65 bps 
B D                D. melanogaster  tttt-gacaatttct-ccgcgc---t------a-a----cg-----------------------------
  D                    D. simulans  tttt-gacaatttct--cacga---t------a-a----caagt--------------------------
B D                   D. sechellia  tttt-gaaaatttct--cacga---t------a-a----caagt--------------------------
                         D. erecta  tttt-tatcatttct--catga---taagacca-a----cgaat--ttcacttattctccgccctaacaa
                         D. yakuba  ttttagatcatttcc--aatga---t------a-agacccaagtagtttacatattctccgcattaacaa
                     D. ficusphila  tatt-tccttttacc--tagag---t------a-a----cccct--------------------------
                     D. eugracilis  ttct-ttcattttct--tatcaattt------a-a----tacat-------------------tcaacac
                      D. biarmipes  -ttg-gggatttctcgtgacgc---g------g-a----tcttc--------------------------
                        D. suzukii  -tgt-tgaagttcccatcaagc---g------a-a----caccc--------------------------
                     D. takahashii  --------------------gt---t------a-g----taacc--------------------------
                        D. elegans  -ttc-tactattagtatcaact---t------a-a----tctta-------------------tctattt
                       D. rhopaloa  -ttt-tgcaatcaaaatcatgt---t------gca----tcatg----------------------gtag
                      D. ananassae  ----------------------------------------------------------------------
                    D. bipectinata  ----------------------------------------------------------------------
                      D_subobscura  ----------------------------------------------------------------------
                      A_epiroticus  ----------------------------------------------------------------------
                    D. willistoni  ======================================================================
                     D. grimshawi  ======================================================================
                       D. miranda  ======================================================================
                      D_athabasca  ======================================================================
                 D. pseudoobscura  ======================================================================
                       D_arizonae  ======================================================================
                    D. mojavensis  ======================================================================
                       D. virilis  ======================================================================
                   D_novamexicana  ======================================================================
                    D. albomicans  ======================================================================
                         D_nasuta  ======================================================================
        Proctacanthus_coquilletti  ======================================================================
                Bactrocera_tryoni  ======================================================================
               Belgica_antarctica  ======================================================================
            Culicoides_sonorensis  ======================================================================
                     A. mellifera  ======================================================================
            Lutzomyia_longipalpis  ======================================================================
               Chironomus_tentans  ======================================================================
                        A_farauti  ======================================================================
              Stomoxys_calcitrans  ======================================================================
                 Bactrocera_oleae  ======================================================================
               Ceratitis_capitata  ======================================================================
                  Lucilia_cuprina  ======================================================================
             Bactrocera_latifrons  ======================================================================
              Bactrocera_dorsalis  ======================================================================
            Zeugodacus_cucurbitae  ======================================================================
                      D_americana  ======================================================================
                     M. domestica  ======================================================================
                      D. kikkawai  ======================================================================
                D_pseudoobscura_1  ======================================================================
                        D_obscura  ======================================================================
                          D_hydei  ======================================================================
B D                  D. persimilis  ======================================================================
               Teleopsis_dalmanni  ======================================================================
               Zaprionus_indianus  ======================================================================
    Scaptodrosophila_lebanonensis  ======================================================================
                     T. castaneum  ======================================================================
                        D_serrata  ======================================================================
                        D_montana  ======================================================================

                   D. melanogaster  --------aacttat--c-------agc--------aag-------------------------------
                       D. simulans  --------agcttat--c-------att--------aag-------------------------------
                      D. sechellia  --------agcttat--c-------agt--------aag-------------------------------
                         D. erecta  a--acccaatcttat--c-------agt--------aaattca-----------caaac--agatgatca
                         D. yakuba  t--acccaatcttat--c-------agt--------aaattcaagatcatatcgccaac--aaatgatta
                     D. ficusphila  ------aaaccttat--c-------acttgttttccaaagcaacaatcacaggtacaacaaaaaagataa
                     D. eugracilis  atcgcataacctaat--t-------ttt--------aaa--------gttctgtgctgttgatatgccag
                      D. biarmipes  ----------cagac--cag-----att--------gaa-------------------------------
                        D. suzukii  ----------cagat--ttg-----att--------aaa-------------------------------
                     D. takahashii  ----------aagat--ttg-----atc--------aaa-------------------------------
                        D. elegans  acttcaaaatcatatcattggtatattc--------aac-------------------------------
                       D. rhopaloa  aatatgtaagtagat--ttgccaagatt--------taa-------------------------------
                      D. ananassae  --------atttctt--t-------ggc--------gga-------------------------------
                    D. bipectinata  ---ttttaatttctc--t-------gcc--------agt-------------------------------
                      D_subobscura  ----------------------------------------------------------------------
                      A_epiroticus  ------------ttt--t-------gcc--------aaa-------------------------------
                     D. willistoni  ======================================================================
                      D. grimshawi  ======================================================================
                        D. miranda  ======================================================================
                       D_athabasca  ======================================================================
                  D. pseudoobscura  ======================================================================
                        D_arizonae  ======================================================================
                     D. mojavensis  ======================================================================
                        D. virilis  ======================================================================
                    D_novamexicana  ======================================================================
                     D. albomicans  ======================================================================
                          D_nasuta  ======================================================================
         Proctacanthus_coquilletti  ======================================================================
                 Bactrocera_tryoni  ======================================================================
                Belgica_antarctica  ======================================================================
             Culicoides_sonorensis  ======================================================================
                      A. mellifera  ======================================================================
             Lutzomyia_longipalpis  ======================================================================
                Chironomus_tentans  ======================================================================
                         A_farauti  ======================================================================
               Stomoxys_calcitrans  ======================================================================
                  Bactrocera_oleae  ======================================================================
                Ceratitis_capitata  ======================================================================
                   Lucilia_cuprina  ======================================================================
              Bactrocera_latifrons  ======================================================================
               Bactrocera_dorsalis  ======================================================================
             Zeugodacus_cucurbitae  ======================================================================
                       D_americana  ======================================================================
                      M. domestica  ======================================================================
                       D. kikkawai  ======================================================================
                 D_pseudoobscura_1  ======================================================================
                         D_obscura  ======================================================================
                           D_hydei  ======================================================================
                     D. persimilis  ======================================================================
                Teleopsis_dalmanni  ======================================================================
                Zaprionus_indianus  ======================================================================
     Scaptodrosophila_lebanonensis  ======================================================================
                      T. castaneum  ======================================================================
                         D_serrata  ======================================================================
                         D_montana  ======================================================================

                   D. melanogaster  --------ttccttc------------cga----------tttcttcggat-tttat-------------
                       D. simulans  --------ttccttc------------cga----------tttcttcggct-tttat-------------
                      D. sechellia  --------ttccttc------------cga----------ttttttcggct-tttat-------------
                         D. erecta  aattcagtttccttc------------cga----------tttcattggct-tttat-------------
                         D. yakuba  aattcagtttccttc------------cga----------tttcgtgggct-tttat-------------
                     D. ficusphila  aa------gaccacc------------aga----------attcgctgttc-tttat-------------
                     D. eugracilis  tttacaatttcccct------------tag----------tctctgtaatg-tttat-------------
                      D. biarmipes  atcacggtt-ccc--------------cga----------tttc-cttgcc-tctat-------------
                        D. suzukii  atcactgttcccc--------------cga----------tttcgctgact-tttat-------------
                     D. takahashii  atctcagttccccta------------cga----------tttctttgatt-tttat-------------
                        D. elegans  tttacaaattccacc------------cga----------tttctgtgattctctat-------------
                       D. rhopaloa  ttcacaaattccacc------------cga----------tttccgtgatt-tttat-------------
                      D. ananassae  ----tggtttcccac------------taaagagccccctcttccaag----cccaa-------------
                    D. bipectinata  ----tggtttcccacagaagccctctatgaagtgcccttttctctcagtgt-cttgg-------------
                      D_subobscura  --ctctgtctctccc-------------------------tctgtggggct-cctac-------------
                      A_epiroticus  ccccccgtgcattgc------------caa----------cgtcttccatt-tcaaccgatccgaaaact
                     D. willistoni  ======================================================================
                      D. grimshawi  ======================================================================
                        D. miranda  ======================================================================
                       D_athabasca  ======================================================================
                  D. pseudoobscura  ======================================================================
                        D_arizonae  ======================================================================
                     D. mojavensis  ======================================================================
                        D. virilis  ======================================================================
                    D_novamexicana  ======================================================================
                     D. albomicans  ======================================================================
                          D_nasuta  ======================================================================
         Proctacanthus_coquilletti  ======================================================================
                 Bactrocera_tryoni  ======================================================================
                Belgica_antarctica  ======================================================================
             Culicoides_sonorensis  ======================================================================
                      A. mellifera  ======================================================================
             Lutzomyia_longipalpis  ======================================================================
                Chironomus_tentans  ======================================================================
                         A_farauti  ======================================================================
               Stomoxys_calcitrans  ======================================================================
                  Bactrocera_oleae  ======================================================================
                Ceratitis_capitata  ======================================================================
                   Lucilia_cuprina  ======================================================================
              Bactrocera_latifrons  ======================================================================
               Bactrocera_dorsalis  ======================================================================
             Zeugodacus_cucurbitae  ======================================================================
                       D_americana  ======================================================================
                      M. domestica  ======================================================================
                       D. kikkawai  ======================================================================
                 D_pseudoobscura_1  ======================================================================
                         D_obscura  ======================================================================
                           D_hydei  ======================================================================
                     D. persimilis  ======================================================================
                Teleopsis_dalmanni  ======================================================================
                Zaprionus_indianus  ======================================================================
     Scaptodrosophila_lebanonensis  ======================================================================
                      T. castaneum  ======================================================================
                         D_serrata  ======================================================================
                         D_montana  ======================================================================

                   D. melanogaster  --
                       D. simulans  --
                      D. sechellia  --
                         D. erecta  --
                         D. yakuba  --
                     D. ficusphila  --
                     D. eugracilis  --
                      D. biarmipes  --
                        D. suzukii  --
                     D. takahashii  --
                        D. elegans  --
                       D. rhopaloa  --
                      D. ananassae  --
                    D. bipectinata  --
                      D_subobscura  --
                      A_epiroticus  tg
                     D. willistoni  ==
                      D. grimshawi  ==
                        D. miranda  ==
                       D_athabasca  ==
                  D. pseudoobscura  ==
                        D_arizonae  ==
                     D. mojavensis  ==
                        D. virilis  ==
                    D_novamexicana  ==
                     D. albomicans  ==
                          D_nasuta  ==
         Proctacanthus_coquilletti  ==
                 Bactrocera_tryoni  ==
                Belgica_antarctica  ==
             Culicoides_sonorensis  ==
                      A. mellifera  ==
             Lutzomyia_longipalpis  ==
                Chironomus_tentans  ==
                         A_farauti  ==
               Stomoxys_calcitrans  ==
                  Bactrocera_oleae  ==
                Ceratitis_capitata  ==
                   Lucilia_cuprina  ==
              Bactrocera_latifrons  ==
               Bactrocera_dorsalis  ==
             Zeugodacus_cucurbitae  ==
                       D_americana  ==
                      M. domestica  ==
                       D. kikkawai  ==
                 D_pseudoobscura_1  ==
                         D_obscura  ==
                           D_hydei  ==
                     D. persimilis  ==
                Teleopsis_dalmanni  ==
                Zaprionus_indianus  ==
     Scaptodrosophila_lebanonensis  ==
                      T. castaneum  ==
                         D_serrata  ==
                         D_montana  ==

Inserts between block 74 and 75 in window
                     D_subobscura 4bp

Alignment block 75 of 1353 in window, 827762 - 827771, 10 bps 
B D                D. melanogaster  cagcagtgta
  D                    D. simulans  cagcagtgta
B D                   D. sechellia  cagcagtgta
                         D. erecta  aggcagtgta
                         D. yakuba  cagcagtgta
                     D. ficusphila  caccagtgta
                     D. eugracilis  cagcagtgta
                      D. biarmipes  cagcagtgta
                        D. suzukii  cagcagtgta
                     D. takahashii  cagcagtgta
                        D. elegans  caccagtgta
                       D. rhopaloa  caccagtgta
                       D. kikkawai  cagaggcctg
                      D. ananassae  gagctttctt
                    D. bipectinata  gggctgcctt
                      D_subobscura  --gcaaggca
                      A_epiroticus  cagcacttca
                    D. willistoni  ==========
                     D. grimshawi  ==========
                       D. miranda  ==========
                      D_athabasca  ==========
                 D. pseudoobscura  ==========
                       D_arizonae  ==========
                    D. mojavensis  ==========
                       D. virilis  ==========
                   D_novamexicana  ==========
                    D. albomicans  ==========
                         D_nasuta  ==========
        Proctacanthus_coquilletti  ==========
                Bactrocera_tryoni  ==========
               Belgica_antarctica  ==========
            Culicoides_sonorensis  ==========
                     A. mellifera  ==========
            Lutzomyia_longipalpis  ==========
               Chironomus_tentans  ==========
                        A_farauti  ==========
              Stomoxys_calcitrans  ==========
                 Bactrocera_oleae  ==========
               Ceratitis_capitata  ==========
                  Lucilia_cuprina  ==========
             Bactrocera_latifrons  ==========
              Bactrocera_dorsalis  ==========
            Zeugodacus_cucurbitae  ==========
                      D_americana  ==========
                     M. domestica  ==========
                D_pseudoobscura_1  ==========
                        D_obscura  ==========
                          D_hydei  ==========
B D                  D. persimilis  ==========
               Teleopsis_dalmanni  ==========
               Zaprionus_indianus  ==========
    Scaptodrosophila_lebanonensis  ==========
                     T. castaneum  ==========
                        D_serrata  ==========
                        D_montana  ==========

Alignment block 76 of 1353 in window, 827772 - 827772, 1 bps 
B D                D. melanogaster  a
  D                    D. simulans  a
B D                   D. sechellia  a
                         D. erecta  a
                         D. yakuba  a
                     D. ficusphila  a
                     D. eugracilis  a
                      D. biarmipes  a
                        D. suzukii  a
                     D. takahashii  a
                        D. elegans  a
                       D. rhopaloa  a
                       D. kikkawai  t
                       D_athabasca  a
                 D_pseudoobscura_1  a
                        D. miranda  a
B D                  D. persimilis  a
                  D. pseudoobscura  a
                         D_obscura  a
                      A_epiroticus  a
                    D. willistoni  =
                     D. grimshawi  =
                     D. ananassae  -
                       D_arizonae  =
                    D. mojavensis  =
                       D. virilis  =
                   D_novamexicana  =
                    D. albomicans  =
                         D_nasuta  =
        Proctacanthus_coquilletti  =
                Bactrocera_tryoni  =
               Belgica_antarctica  =
            Culicoides_sonorensis  =
                     A. mellifera  =
            Lutzomyia_longipalpis  =
               Chironomus_tentans  =
                        A_farauti  =
              Stomoxys_calcitrans  =
                 Bactrocera_oleae  =
               Ceratitis_capitata  =
                  Lucilia_cuprina  =
             Bactrocera_latifrons  =
              Bactrocera_dorsalis  =
            Zeugodacus_cucurbitae  =
                      D_americana  =
                     M. domestica  =
                   D. bipectinata  -
                     D_subobscura  -
                          D_hydei  =
               Teleopsis_dalmanni  =
               Zaprionus_indianus  =
    Scaptodrosophila_lebanonensis  =
                     T. castaneum  =
                        D_serrata  =
                        D_montana  =

Alignment block 77 of 1353 in window, 827773 - 827837, 65 bps 
B D                D. melanogaster  tgtcaatgtctcggctg------------tt--------------g------ggcttat-----------
  D                    D. simulans  tgtcaatgtctcggctg------------tt--------------g------ggcttat-----------
B D                   D. sechellia  tgtcaatgtctcgtctg------------tt--------------g------ggcttat-----------
                         D. erecta  tgtcaatgtctcggctg------------gt--------------g------ggcatat-----------
                         D. yakuba  tgtcaatgtctcggctg------------tt--------------g------ggcttat-----------
                     D. ficusphila  tgtcaatgtcttggcag-----------ctt--------------g------ggcttat-----------
                     D. eugracilis  tgtcaatgtcttggctg------------tt--------------g------ggcttat-----------
                      D. biarmipes  tgtcaatgtctcggctg------------t----------------------ggcttat-----------
                        D. suzukii  tgtcaatgtctcggctg------------tt--------------g------ggcttat-----------
                     D. takahashii  tgtcaatgtctcggctg------------tt--------------g------ggcttat-----------
                        D. elegans  tgtcaatgtcttg---------------------------------------ggcttat-----------
                       D. rhopaloa  tgtcaatgtcttg---------------------------------------ggcttat-----------
                         D_serrata  tgtcaatgtcttggctg------------ttgtttggac------g------gccttat-----------
                       D. kikkawai  tgtcaatgtcttggctg------------ttgtttggac------g------gacttat-----------
                      D. ananassae  tgtcaatgtcttgtctt------------gtcttgtgttgtcttggctcttgggcttat-----------
                    D. bipectinata  tgtcaatgtcttggctg------------ctc-------------gctc---ggcttat-----------
                       D_athabasca  tgtcaatgtcttggctgtggcactggctctg--------------t------ggctcctacttatgcaag
                 D_pseudoobscura_1  tgtcaatgtcttggctg------------tg--------------c------ggctcct-----------
                        D. miranda  tgtcaatgtcttggctg------------tg--------------t------ggctcct-----------
B D                  D. persimilis  tgtcaatgtcttggctg------------tg--------------c------ggctcct-----------
                  D. pseudoobscura  tgtcaatgtcttggctg------------tg--------------c------ggctcct-----------
                      D_subobscura  ----------------------------------------------------------------------
                         D_obscura  tgtcaatgtcttggctgtggcactggctctg--------------t------ggctcctacttatgcaag
                      A_epiroticus  ----aatgtttcaactg----------aatg--------------g------gaactgc-----------
                    D. willistoni  ======================================================================
                     D. grimshawi  ======================================================================
                       D_arizonae  ======================================================================
                    D. mojavensis  ======================================================================
                       D. virilis  ======================================================================
                   D_novamexicana  ======================================================================
                    D. albomicans  ======================================================================
                         D_nasuta  ======================================================================
        Proctacanthus_coquilletti  ======================================================================
                Bactrocera_tryoni  ======================================================================
               Belgica_antarctica  ======================================================================
            Culicoides_sonorensis  ======================================================================
                     A. mellifera  ======================================================================
            Lutzomyia_longipalpis  ======================================================================
               Chironomus_tentans  ======================================================================
                        A_farauti  ======================================================================
              Stomoxys_calcitrans  ======================================================================
                 Bactrocera_oleae  ======================================================================
               Ceratitis_capitata  ======================================================================
                  Lucilia_cuprina  ======================================================================
             Bactrocera_latifrons  ======================================================================
              Bactrocera_dorsalis  ======================================================================
            Zeugodacus_cucurbitae  ======================================================================
                      D_americana  ======================================================================
                     M. domestica  ======================================================================
                          D_hydei  ======================================================================
               Teleopsis_dalmanni  ======================================================================
               Zaprionus_indianus  ======================================================================
    Scaptodrosophila_lebanonensis  ======================================================================
                     T. castaneum  ======================================================================
                        D_montana  ======================================================================

                   D. melanogaster  ------gcaagcgc--------------------aaacaata------acaaaacaatcaccaagcc-a-
                       D. simulans  ------gcaagcgc--------------------aaacaata------acaaaacaatcgccaagcc-a-
                      D. sechellia  ------gcaagcgc--------------------aaacaata------acaaaacaatcgccaagcc-a-
                         D. erecta  ------gcaagcgc--------------------aaacaata------acaaaacaatcgccaagcc-a-
                         D. yakuba  ------gcaagcgc--------------------aaacaata------acaaaacaatcgccaagcc-a-
                     D. ficusphila  ------gcaagcgc--------------------aaacaata------acaaaacaattgccaagcc-a-
                     D. eugracilis  ------gcaagcgc--------------------aaacaata------acaaaacaatcgccaagcc-a-
                      D. biarmipes  ------gcaagcgc--------------------aaacaata------acaaaacaat-gccagg-c-a-
                        D. suzukii  ------gcaagcgc--------------------aaacaata------acaaaacaatcgccagg-c-a-
                     D. takahashii  ------gcaagcgc--------------------aaacaata------acaaaacaatcgccaggcc-a-
                        D. elegans  ------gcaagcgc--------------------aaacaata------acaaaacaattgccaagcc-ag
                       D. rhopaloa  ------gcaagcgc--------------------aaacaata------acaaaacaatcgccaagcc-a-
                         D_serrata  ------gcaagcgc--------------------aaacaata------acaaaacaatcgccaagcc-a-
                       D. kikkawai  ------gcaagcgc--------------------aaacaata------acaaaacaattgccaagcc-a-
                      D. ananassae  ------gcaagccccaaacagaaacccaaacccaaaacaata------acaaaacaattgccaagcc-a-
                    D. bipectinata  ------gcaagtcccaaaca------cacaacccaaacaata------acaaaacaatttccaagcc-a-
                       D_athabasca  gcaaggcaaggcaa--------------------caacagag--------aaaacaa-----aagcc-a-
                 D_pseudoobscura_1  ------caaggcaa--------------------caaaagtg-------caaaacaa-----aagcc-a-
                        D. miranda  ------caaggcaa--------------------caaaagtg-------caaaacaa-----aagcc-a-
                     D. persimilis  ------caaggcaa--------------------caaaagtg-------caaaacaa-----aagcc-a-
                  D. pseudoobscura  ------caaggcaa--------------------caaaagtg-------caaaacaa-----aagccaa-
                      D_subobscura  ----aaccaaacac--------------------agccagtgaaa---acaaaacaa-----aagccga-
                         D_obscura  g-----caaggcaa--------------------caacagtgaaa---acaaaacaa-----aagccga-
                      A_epiroticus  ------gctagcaa--------------------acaaggtgccgcttacaacgtacttcacaagcc-a-
                     D. willistoni  ======================================================================
                      D. grimshawi  ======================================================================
                        D_arizonae  ======================================================================
                     D. mojavensis  ======================================================================
                        D. virilis  ======================================================================
                    D_novamexicana  ======================================================================
                     D. albomicans  ======================================================================
                          D_nasuta  ======================================================================
         Proctacanthus_coquilletti  ======================================================================
                 Bactrocera_tryoni  ======================================================================
                Belgica_antarctica  ======================================================================
             Culicoides_sonorensis  ======================================================================
                      A. mellifera  ======================================================================
             Lutzomyia_longipalpis  ======================================================================
                Chironomus_tentans  ======================================================================
                         A_farauti  ======================================================================
               Stomoxys_calcitrans  ======================================================================
                  Bactrocera_oleae  ======================================================================
                Ceratitis_capitata  ======================================================================
                   Lucilia_cuprina  ======================================================================
              Bactrocera_latifrons  ======================================================================
               Bactrocera_dorsalis  ======================================================================
             Zeugodacus_cucurbitae  ======================================================================
                       D_americana  ======================================================================
                      M. domestica  ======================================================================
                           D_hydei  ======================================================================
                Teleopsis_dalmanni  ======================================================================
                Zaprionus_indianus  ======================================================================
     Scaptodrosophila_lebanonensis  ======================================================================
                      T. castaneum  ======================================================================
                         D_montana  ======================================================================

                   D. melanogaster  ----aa
                       D. simulans  ----aa
                      D. sechellia  ----aa
                         D. erecta  ----ag
                         D. yakuba  ----aa
                     D. ficusphila  ----aa
                     D. eugracilis  ----aa
                      D. biarmipes  ----gc
                        D. suzukii  ----aa
                     D. takahashii  ----aa
                        D. elegans  aaagaa
                       D. rhopaloa  ----aa
                         D_serrata  ----aa
                       D. kikkawai  ----aa
                      D. ananassae  ----aa
                    D. bipectinata  ----aa
                       D_athabasca  ----aa
                 D_pseudoobscura_1  ----aa
                        D. miranda  ----aa
                     D. persimilis  ----aa
                  D. pseudoobscura  ----aa
                      D_subobscura  ----aa
                         D_obscura  ----aa
                      A_epiroticus  ----aa
                     D. willistoni  ======
                      D. grimshawi  ======
                        D_arizonae  ======
                     D. mojavensis  ======
                        D. virilis  ======
                    D_novamexicana  ======
                     D. albomicans  ======
                          D_nasuta  ======
         Proctacanthus_coquilletti  ======
                 Bactrocera_tryoni  ======
                Belgica_antarctica  ======
             Culicoides_sonorensis  ======
                      A. mellifera  ======
             Lutzomyia_longipalpis  ======
                Chironomus_tentans  ======
                         A_farauti  ======
               Stomoxys_calcitrans  ======
                  Bactrocera_oleae  ======
                Ceratitis_capitata  ======
                   Lucilia_cuprina  ======
              Bactrocera_latifrons  ======
               Bactrocera_dorsalis  ======
             Zeugodacus_cucurbitae  ======
                       D_americana  ======
                      M. domestica  ======
                           D_hydei  ======
                Teleopsis_dalmanni  ======
                Zaprionus_indianus  ======
     Scaptodrosophila_lebanonensis  ======
                      T. castaneum  ======
                         D_montana  ======

Alignment block 78 of 1353 in window, 827838 - 827920, 83 bps 
B D                D. melanogaster  gaaa-tccaaacaccgatccg-aatcc-a-----------a------cggt-ggtgcatttc-----agt
  D                    D. simulans  gaaa-tccaaacaccacttcg-aatcc-g-----------a------cggt-ggtgcatttc-----agt
B D                   D. sechellia  gaaa-tccaaacaccacttcg-aatcc-g-----------a------cggt-ggtgcatttc-----agt
                         D. erecta  gaaa-tccaaacaccaatccg-aatcc-a-----------a------cggt-ggtgcatttc-----agt
                         D. yakuba  gaaa-tccaaacaccaatccg-aatcc-a-----------a------cggt-ggtgcatttc-----agt
                     D. ficusphila  gaaa------------atcca-aatcc-a-----------a------cggt-ggtgcatttc-----agt
                     D. eugracilis  gaaaagccaaacacaaatccg-aatcc-a-----------a------cggt-ggtgcagttc-----agt
                      D. biarmipes  g-aaatccgc------atcca-aatcc-a-----------a------cggt-ggtgcctttc-----agt
                        D. suzukii  gaaaatccac------atcca-aatcc-a-----------a------cggt-ggtgcatttc-----agt
                     D. takahashii  gaaaatccac------atccc-aatccaa-----------a------cggt-ggtgcatttc-----agt
                        D. elegans  gaaaatcca-------------aatcc-a-----------a------cggt-ggtgcagttc-----agt
                       D. rhopaloa  gaaaatcca-------------aatcc-a-----------a------cggt-ggtgcagttcagtttagt
                         D_serrata  gaaaatccaa------atccgaaaccc-a-----------a------cggt-ggtgc----------agt
                       D. kikkawai  gaaaatccaa------atccgaaaccc-a-----------a------cagc-agtgc----------agt
                      D. ananassae  gaaa------------atcca-agcca-a-----------t------cggt-ggtgc----------agt
                    D. bipectinata  gaaa------------atccc-aatcc-a-----------tcactgccggt-ggtgc----------agt
                       D_athabasca  gaaa------------atcca-aatcc-a---------ttg------ctgc-atcgccgtgc-----agt
                 D_pseudoobscura_1  gaaa------------atcca-aatcc-a---------ttg------ctgc-atcgccgtgc-----agt
                        D. miranda  gaaa------------atcca-aatcc-a---------ttg------ctgc-atcgccgtgc-----agt
B D                  D. persimilis  gaaa------------atcca-aatcc-a---------ttg------ctgc-atcgccgtgc-----agt
                  D. pseudoobscura  gaaa------------atcca-aatcc-a---------ttg------ctgc-atcgccgtgc-----agt
                      D_subobscura  gaaa------------atcca-aatcc-aaatccatcgctg------ctgcaagcgccgtgc-----agt
                         D_obscura  gaaa------------atcca-aatcc-a---------tcg------ccgc-atcgcagtgc-----agt
                    D. willistoni  ======================================================================
                     D. grimshawi  ======================================================================
                       D_arizonae  ======================================================================
                    D. mojavensis  ======================================================================
                       D. virilis  ======================================================================
                   D_novamexicana  ======================================================================
                    D. albomicans  ======================================================================
                         D_nasuta  ======================================================================
        Proctacanthus_coquilletti  ======================================================================
                Bactrocera_tryoni  ======================================================================
               Belgica_antarctica  ======================================================================
            Culicoides_sonorensis  ======================================================================
                     A. mellifera  ======================================================================
            Lutzomyia_longipalpis  ======================================================================
               Chironomus_tentans  ======================================================================
                        A_farauti  ======================================================================
              Stomoxys_calcitrans  ======================================================================
                 Bactrocera_oleae  ======================================================================
               Ceratitis_capitata  ======================================================================
                  Lucilia_cuprina  ======================================================================
             Bactrocera_latifrons  ======================================================================
              Bactrocera_dorsalis  ======================================================================
            Zeugodacus_cucurbitae  ======================================================================
                      D_americana  ======================================================================
                     M. domestica  ======================================================================
                          D_hydei  ======================================================================
               Teleopsis_dalmanni  ======================================================================
               Zaprionus_indianus  ======================================================================
    Scaptodrosophila_lebanonensis  ======================================================================
                     T. castaneum  ======================================================================
                        D_montana  ======================================================================

                   D. melanogaster  tcattggcagccagccagccagccaggcgtttcatg-ttt
                       D. simulans  tcattgg----cagccagccagccaggcgtttcatg-ttt
                      D. sechellia  tcattgg----cagccagccagccaggcgtttcatg-ttt
                         D. erecta  tcattgg----cagccagccagccaggcgtttcatg-ttt
                         D. yakuba  tcattgg----cagtcagccagccaggcgtttcatg-ttt
                     D. ficusphila  tcattgg----cagccagccagccaagcgattcatg-ttt
                     D. eugracilis  tcattgg----cagccagccagccaagcgtttcatg-ttt
                      D. biarmipes  tcattgg----cagccagccagccaagcgtttcatg-ttc
                        D. suzukii  tcattgg----cagccagccagccaagcgtttcatg-ttt
                     D. takahashii  tcattgg----cagccagccagccaagcgtttcatg-ttt
                        D. elegans  tcattgg----cagtcagccagccaagcgtttcatg-ttt
                       D. rhopaloa  tcattgg----cagccagccagccaagcgtttcatg-ttt
                         D_serrata  tcattgg----cagccagccagccaagcgtttcatg-ttt
                       D. kikkawai  tcattggcagccagccagccagccaagcgtttcatg-ttt
                      D. ananassae  tcattgg----caggcagccagcgaagcgtttcatg-ttc
                    D. bipectinata  tcattgg----caggcagccagcgaagcgtgt--------
                       D_athabasca  tcattgg----cagggggccagccaagcgtttcatg-ttt
                 D_pseudoobscura_1  tcattgg----cagggggccagccgaacgtttcaag-ttt
                        D. miranda  tcattgg----cagggggccagccgaacgtttcaag-ttt
                     D. persimilis  tcattgg----cagggggccagccgaacgtttcaagtttt
                  D. pseudoobscura  tcattgg----cagggggccagccgaacgtttcaag-ttt
                      D_subobscura  tcattgg----cagcgggccagccaagcgtttcatg-ttt
                         D_obscura  tcattgg----cagcgggccagccaagcgtttcatg-ttt
                     D. willistoni  ========================================
                      D. grimshawi  ========================================
                        D_arizonae  ========================================
                     D. mojavensis  ========================================
                        D. virilis  ========================================
                    D_novamexicana  ========================================
                     D. albomicans  ========================================
                          D_nasuta  ========================================
         Proctacanthus_coquilletti  ========================================
                 Bactrocera_tryoni  ========================================
                Belgica_antarctica  ========================================
             Culicoides_sonorensis  ========================================
                      A. mellifera  ========================================
             Lutzomyia_longipalpis  ========================================
                Chironomus_tentans  ========================================
                         A_farauti  ========================================
               Stomoxys_calcitrans  ========================================
                  Bactrocera_oleae  ========================================
                Ceratitis_capitata  ========================================
                   Lucilia_cuprina  ========================================
              Bactrocera_latifrons  ========================================
               Bactrocera_dorsalis  ========================================
             Zeugodacus_cucurbitae  ========================================
                       D_americana  ========================================
                      M. domestica  ========================================
                           D_hydei  ========================================
                Teleopsis_dalmanni  ========================================
                Zaprionus_indianus  ========================================
     Scaptodrosophila_lebanonensis  ========================================
                      T. castaneum  ========================================
                         D_montana  ========================================

Inserts between block 78 and 79 in window
                     D. ananassae 1bp
                      D_athabasca 1bp
                D_pseudoobscura_1 53bp

Alignment block 79 of 1353 in window, 827921 - 827966, 46 bps 
B D                D. melanogaster  accaagtcccc------------------------aagcg-----aac---------------cgaactg
  D                    D. simulans  accaagtcccc------------------------aagcg-----aac---------------cgaactg
B D                   D. sechellia  accaagtcccc------------------------aagcg-----aac---------------agaactg
                         D. erecta  accaagtcccc------------------------aacctaacacaac---------------cgaaccg
                         D. yakuba  accaagtcccc------------------------aacca-----aac---------------cgaaccg
                     D. ficusphila  accaaggccct---------------------------cg------------------------------
                     D. eugracilis  accaagtccct------------------------taccg-----aac---------------c--ccga
                      D. biarmipes  accaaggcccagtcccagtcacagtcccgagcccgagccc-----atccccca---------accactcg
                        D. suzukii  accaaggccca------------------aacccaaaccc-----atc---------------ccatccg
                     D. takahashii  accaaggcccaatccaa------------atcggaatccc-----agt---------------caaaccg
                        D. elegans  accagggcctcctcctcctcctcctcctcctcctcgtact-----cgt-----------------actcg
                       D. rhopaloa  accaaggc----------------------------------------------------------ctcg
                         D_serrata  acccag-----------------------------agtgg-----agt------------------tcca
                       D. kikkawai  acccag-----------------------------agtgg-----agc------------------tcca
                      D. ananassae  acaacctcctc------------------------ctcct-----cct---------------cctcctc
                    D. bipectinata  accacctcctc--------------------------cct-----cct---------------ctttagg
                       D_athabasca  ----------------------------------------------------------------------
                        D. miranda  -------------------------------------------------ttcgtggtggtggtggtgttg
B D                  D. persimilis  -------------------------------------------------ttcttggtggtggtgctgttg
                  D. pseudoobscura  -------------------------------------------------ttcttggtggtggtgctgttg
                      D_subobscura  --------------------------------------------------------------ttttctgg
                         D_obscura  -------------------------------------------------ttcttggtcgtcgtggtattc
                    D. willistoni  ======================================================================
                     D. grimshawi  ======================================================================
                       D_arizonae  ======================================================================
                    D. mojavensis  ======================================================================
                       D. virilis  ======================================================================
                   D_novamexicana  ======================================================================
                    D. albomicans  ======================================================================
                         D_nasuta  ======================================================================
        Proctacanthus_coquilletti  ======================================================================
                Bactrocera_tryoni  ======================================================================
               Belgica_antarctica  ======================================================================
            Culicoides_sonorensis  ======================================================================
                     A. mellifera  ======================================================================
            Lutzomyia_longipalpis  ======================================================================
               Chironomus_tentans  ======================================================================
                        A_farauti  ======================================================================
              Stomoxys_calcitrans  ======================================================================
                 Bactrocera_oleae  ======================================================================
               Ceratitis_capitata  ======================================================================
                  Lucilia_cuprina  ======================================================================
             Bactrocera_latifrons  ======================================================================
              Bactrocera_dorsalis  ======================================================================
            Zeugodacus_cucurbitae  ======================================================================
                      D_americana  ======================================================================
                     M. domestica  ======================================================================
                D_pseudoobscura_1  ======================================================================
                          D_hydei  ======================================================================
               Teleopsis_dalmanni  ======================================================================
               Zaprionus_indianus  ======================================================================
    Scaptodrosophila_lebanonensis  ======================================================================
                     T. castaneum  ======================================================================
                        D_montana  ======================================================================

                   D. melanogaster  aacc-g-c---------cccctta---t---------cactcc
                       D. simulans  aacc-g-c---------cccctta---t---------cactcg
                      D. sechellia  aacc-g-c---------cccctta---t---------cactcg
                         D. erecta  aacc-g-c---------cccctta---t---------cactcg
                         D. yakuba  aacc-g-c---------cccctta---t---------cactcg
                     D. ficusphila  -tcc-g-c---------cccctta---t---------cactct
                     D. eugracilis  aacc-g-c---------cccctta---t---------cactcg
                      D. biarmipes  aacc-g-agcccagccgcccctta---t---------cacccg
                        D. suzukii  aacc-g-c---------cccctta---t---------cactcg
                     D. takahashii  aacc-g-c---------cccctta---t---------cactcg
                        D. elegans  tacc-g-c---------cccctta---t---------cactcg
                       D. rhopaloa  tacc-gcc---------cccctta---t---------cactga
                         D_serrata  cctc-g-t---------ctccc---------------cacctt
                       D. kikkawai  cctc-g-t---------ccccctc---a---------cacctt
                      D. ananassae  ctcc-t-c---------ctctcgt---tgggggcacccaccag
                    D. bipectinata  ggca-c-c---------cacctgg---t---------------
                       D_athabasca  gtcc-t-c---------cccctat---g---------cgcct-
                        D. miranda  gtcc-t-c---------cccctat---c---------cgcct-
                     D. persimilis  gtcc-t-c---------cccctat---c---------cgcct-
                  D. pseudoobscura  gtcc-t-c---------cccctat---c---------cgcct-
                      D_subobscura  gtccac-c---------cccctatatgc---------cgcct-
                         D_obscura  gtcc-t-c---------cccctat---g---------cgcat-
                     D. willistoni  ===========================================
                      D. grimshawi  ===========================================
                        D_arizonae  ===========================================
                     D. mojavensis  ===========================================
                        D. virilis  ===========================================
                    D_novamexicana  ===========================================
                     D. albomicans  ===========================================
                          D_nasuta  ===========================================
         Proctacanthus_coquilletti  ===========================================
                 Bactrocera_tryoni  ===========================================
                Belgica_antarctica  ===========================================
             Culicoides_sonorensis  ===========================================
                      A. mellifera  ===========================================
             Lutzomyia_longipalpis  ===========================================
                Chironomus_tentans  ===========================================
                         A_farauti  ===========================================
               Stomoxys_calcitrans  ===========================================
                  Bactrocera_oleae  ===========================================
                Ceratitis_capitata  ===========================================
                   Lucilia_cuprina  ===========================================
              Bactrocera_latifrons  ===========================================
               Bactrocera_dorsalis  ===========================================
             Zeugodacus_cucurbitae  ===========================================
                       D_americana  ===========================================
                      M. domestica  ===========================================
                 D_pseudoobscura_1  ===========================================
                           D_hydei  ===========================================
                Teleopsis_dalmanni  ===========================================
                Zaprionus_indianus  ===========================================
     Scaptodrosophila_lebanonensis  ===========================================
                      T. castaneum  ===========================================
                         D_montana  ===========================================

Inserts between block 79 and 80 in window
                      D_athabasca 13bp
                       D. miranda 12bp
B D                 D. persimilis 12bp
                 D. pseudoobscura 12bp
                     D_subobscura 16bp
                        D_obscura 16bp

Alignment block 80 of 1353 in window, 827967 - 827992, 26 bps 
B D                D. melanogaster  agcatttgcataa----atataatcttttt
  D                    D. simulans  agcatttgcacaa----acataatcttttt
B D                   D. sechellia  agcatttgcacaa----acataatcttttt
                         D. erecta  agcattggcacaa----acataatcttttt
                         D. yakuba  agcatttgcacaa----acataatcttttt
                     D. ficusphila  agcatttgcacaa----acataatcttttt
                     D. eugracilis  agcatttgcacaa----acataatcttttt
                      D. biarmipes  ggcatttgcacaa----acataatc--ttt
                        D. suzukii  agcatttgcacaa----acataatcttttt
                     D. takahashii  agcatttgcacaa----acataatcttttt
                        D. elegans  agcatttgcacaa----acataatcttttt
                       D. rhopaloa  agcatttgcacaa----acataatcttttt
                         D_serrata  atcaccatc-gag----tcacaatcttttt
                       D. kikkawai  atcaccatcggag----acacaatcttttt
                      D. ananassae  agc-------cag----gtagtacctcctt
                    D. bipectinata  agc-------c--------agcccctcctt
                       D_athabasca  agtatttgcacaaacaaacataatcttctt
                 D_pseudoobscura_1  agcatttgcacaaacatacataatcttttt
                        D. miranda  agcatttgcacaaacatacataatcttttt
B D                  D. persimilis  agcatttgcacaaacatacataatcttttt
                  D. pseudoobscura  agcatttgcacaaacatacataatcttttt
                      D_subobscura  aacatttgcacaaa---acataatctttt-
                         D_obscura  agcatttgcacaa----acataatcttttt
                    D. willistoni  ==============================
                     D. grimshawi  ==============================
                       D_arizonae  ==============================
                    D. mojavensis  ==============================
                       D. virilis  ==============================
                   D_novamexicana  ==============================
                    D. albomicans  ==============================
                         D_nasuta  ==============================
        Proctacanthus_coquilletti  ==============================
                Bactrocera_tryoni  ==============================
               Belgica_antarctica  ==============================
            Culicoides_sonorensis  ==============================
                     A. mellifera  ==============================
            Lutzomyia_longipalpis  ==============================
               Chironomus_tentans  ==============================
                        A_farauti  ==============================
              Stomoxys_calcitrans  ==============================
                 Bactrocera_oleae  ==============================
               Ceratitis_capitata  ==============================
                  Lucilia_cuprina  ==============================
             Bactrocera_latifrons  ==============================
              Bactrocera_dorsalis  ==============================
            Zeugodacus_cucurbitae  ==============================
                      D_americana  ==============================
                     M. domestica  ==============================
                          D_hydei  ==============================
               Teleopsis_dalmanni  ==============================
               Zaprionus_indianus  ==============================
    Scaptodrosophila_lebanonensis  ==============================
                     T. castaneum  ==============================
                        D_montana  ==============================

Inserts between block 80 and 81 in window
                       D. elegans 1bp
                     D. ananassae 10bp
                   D. bipectinata 10bp

Alignment block 81 of 1353 in window, 827993 - 827993, 1 bps 
B D                D. melanogaster  c
  D                    D. simulans  c
B D                   D. sechellia  c
                         D. erecta  c
                         D. yakuba  c
                     D. ficusphila  t
                     D. eugracilis  t
                      D. biarmipes  c
                        D. suzukii  t
                     D. takahashii  t
                       D. rhopaloa  t
                         D_serrata  t
                       D. kikkawai  t
                       D_athabasca  g
                 D_pseudoobscura_1  c
                        D. miranda  c
B D                  D. persimilis  c
                  D. pseudoobscura  c
                         D_obscura  g
                    D. willistoni  =
                     D. grimshawi  =
                     D. ananassae  =
                       D_arizonae  =
                    D. mojavensis  =
                       D. virilis  =
                   D_novamexicana  =
                    D. albomicans  =
                         D_nasuta  =
        Proctacanthus_coquilletti  =
                Bactrocera_tryoni  =
               Belgica_antarctica  =
            Culicoides_sonorensis  =
                     A. mellifera  =
            Lutzomyia_longipalpis  =
               Chironomus_tentans  =
                        A_farauti  =
              Stomoxys_calcitrans  =
                 Bactrocera_oleae  =
               Ceratitis_capitata  =
                  Lucilia_cuprina  =
             Bactrocera_latifrons  =
              Bactrocera_dorsalis  =
            Zeugodacus_cucurbitae  =
                      D_americana  =
                     M. domestica  =
                   D. bipectinata  =
                     D_subobscura  -
                          D_hydei  =
                       D. elegans  =
               Teleopsis_dalmanni  =
               Zaprionus_indianus  =
    Scaptodrosophila_lebanonensis  =
                     T. castaneum  =
                        D_montana  =

Alignment block 82 of 1353 in window, 827994 - 828029, 36 bps 
B D                D. melanogaster  g-------------ggttctttctc---cg--tt-tctatctgggttcggttac------g
  D                    D. simulans  g-------------ggttctttctc---cg--tt-tctatctgggttcggttac------g
B D                   D. sechellia  g-------------ggttctttctc---cg--tt-tctatctgggttcggttac------g
                         D. erecta  g-------------ggttctttctc---cg---t-gctatctgggtttggttac------g
                         D. yakuba  g-------------ggttctttctc---cg---t-gctatctgggttcggttac------g
                     D. ficusphila  g-------------ggttctttctc---cg--tt-gctatctgggttcggttac------g
                     D. eugracilis  g-------------ggttctttctc---cg--tt-gctatctgggttcggttac------g
                      D. biarmipes  g-------------ggttctttctc---cg--ct-gccatctgggctcggttac-gccacg
                        D. suzukii  g-------------ggttctttctc---cg--tt-gccatctgggttcggttacggttacg
                     D. takahashii  g-------------ggttctttctc---cg--tt-gctatcttggttcggttac------g
                        D. elegans  g-------------ggttctttctc---cg--ta-gctatctgggttcggttac------g
                       D. rhopaloa  g-------------ggttctttctc---cg--ta-gctatctgggttcggttac------g
                         D_serrata  g-------------ggttctttctc---tg--cc-gctatct-ggctcggttac------g
                       D. kikkawai  g-------------ggttctttctc---tg--cc-gctatct-ggctcggttac------g
                      D. ananassae  a-------------ggttcttgctgggcgg--gtggccatct-gtcacggttac------a
                    D. bipectinata  gagcttgggcttttggttctttctg---gg--gt-gccatct-gtcacggttac------a
                       D_athabasca  g-------------ttctctctc----------------------ttcgtcttc------a
                 D_pseudoobscura_1  g-------------aattctttcgc---tc--tt-ctgttttggattcggtttc------a
                        D. miranda  g-------------gattctttcgc---tc--tt-ctgttttggattcggtttc------a
B D                  D. persimilis  g-------------aattctttcgc---ac--tt-ctgttttggattcggtttc------a
                  D. pseudoobscura  g-------------aattctttcgc---tc--tt-ctgttttggattcggtttc------a
                      D_subobscura  --------------ggttctttctt---ttcgtc-gtgttttgggttcggtttc------a
                         D_obscura  g-------------------------------tt-ctgttttgggttcgttttc------a
                    D. willistoni  =============================================================
                     D. grimshawi  =============================================================
                       D_arizonae  =============================================================
                    D. mojavensis  =============================================================
                       D. virilis  =============================================================
                   D_novamexicana  =============================================================
                    D. albomicans  =============================================================
                         D_nasuta  =============================================================
        Proctacanthus_coquilletti  =============================================================
                Bactrocera_tryoni  =============================================================
               Belgica_antarctica  =============================================================
            Culicoides_sonorensis  =============================================================
                     A. mellifera  =============================================================
            Lutzomyia_longipalpis  =============================================================
               Chironomus_tentans  =============================================================
                        A_farauti  =============================================================
              Stomoxys_calcitrans  =============================================================
                 Bactrocera_oleae  =============================================================
               Ceratitis_capitata  =============================================================
                  Lucilia_cuprina  =============================================================
             Bactrocera_latifrons  =============================================================
              Bactrocera_dorsalis  =============================================================
            Zeugodacus_cucurbitae  =============================================================
                      D_americana  =============================================================
                     M. domestica  =============================================================
                          D_hydei  =============================================================
               Teleopsis_dalmanni  =============================================================
               Zaprionus_indianus  =============================================================
    Scaptodrosophila_lebanonensis  =============================================================
                     T. castaneum  =============================================================
                        D_montana  =============================================================

Inserts between block 82 and 83 in window
                        D. erecta 12bp
                        D. yakuba 24bp
                    D. eugracilis 6bp
                     D. ananassae 6bp
                   D. bipectinata 6bp

Alignment block 83 of 1353 in window, 828030 - 828177, 148 bps 
B D                D. melanogaster  gtt------tcact----------c-ccgctttctcctc----------------tcaaaaa--------
  D                    D. simulans  gttacggtttcact----------c-ccgctttctccgc----------------tcaaaaa--------
                         D. erecta  gtt------ccact----------c-ccgctttctccgc----------------tcaagaa--------
                         D. yakuba  gtt------ccact----------g-ccgctttctccgc----------------tcaagaa--------
                     D. ficusphila  gtt------tcgct---c------c-ccgctttctccgc----------------tcaaaaa--------
                     D. eugracilis  gtt------tcact---c------c-ccgctttctctgc----------------taaaaaa--------
                      D. biarmipes  gtt------ccact----------c-ccgctttctcctc--------------gaccagcag--------
                        D. suzukii  gtt------tcact---c------c-ccgctttctcctctg--------aaaaaatgaaaag--------
                     D. takahashii  gtt------tcact---c------c-ccgctttctctgctgaaaaacaaaaaaaatcagaaacccagaaa
                        D. elegans  gtt------tcact---c------c-ccgctttctccgc----------------tcgacaa--------
                       D. rhopaloa  gtt------tcact---c------c-ccgctttctccgc----------------tcg--aa--------
                         D_serrata  gtt------tcact---c------c-ccgctttctcctcgac-----------------aaa--------
                       D. kikkawai  gtt------tcact---c------c-ccgctttctcctcggc-------------acagaga--------
                      D. ananassae  gtt------tcagt---ctcagttt-cagctttctccgc----------------ccggccagttt----
                    D. bipectinata  gtt------tcagt---c------t-cagctttctccac----------------cggacaagtccaa--
                       D_athabasca  --------gcagtt---ggc----t-ccactttctcctatctt-tcc--------caaacgg--------
                 D_pseudoobscura_1  --------gccgct---ggcggagc-ccactttctcccctcttattg--------ccaacga--------
                        D. miranda  --------gccgct---ggcggagc-ccactttctcccctcttattg--------ccaacga--------
B D                  D. persimilis  --------gccgct---ggcggaa-----------cccctcttattg--------ccaacga--------
                  D. pseudoobscura  --------gccgct---ggcggaac-ccactttctcccctcttattg--------ccaacca--------
                      D_subobscura  --------gcagtttcagacggaaa----------ccccacttttct--------ccagcgg--------
                         D_obscura  --------gcagtc---ggcggaacaacactttctccgctat--ttg--------ccaacgg--------
                    D. willistoni  ======================================================================
                     D. grimshawi  ======================================================================
                       D_arizonae  ======================================================================
                    D. mojavensis  ======================================================================
                       D. virilis  ======================================================================
                   D_novamexicana  ======================================================================
                    D. albomicans  ======================================================================
                         D_nasuta  ======================================================================
        Proctacanthus_coquilletti  ======================================================================
                Bactrocera_tryoni  ======================================================================
               Belgica_antarctica  ======================================================================
            Culicoides_sonorensis  ======================================================================
                     A. mellifera  ======================================================================
            Lutzomyia_longipalpis  ======================================================================
               Chironomus_tentans  ======================================================================
                        A_farauti  ======================================================================
              Stomoxys_calcitrans  ======================================================================
                 Bactrocera_oleae  ======================================================================
               Ceratitis_capitata  ======================================================================
                  Lucilia_cuprina  ======================================================================
             Bactrocera_latifrons  ======================================================================
              Bactrocera_dorsalis  ======================================================================
            Zeugodacus_cucurbitae  ======================================================================
                      D_americana  ======================================================================
                     M. domestica  ======================================================================
                          D_hydei  ======================================================================
               Teleopsis_dalmanni  ======================================================================
               Zaprionus_indianus  ======================================================================
    Scaptodrosophila_lebanonensis  ======================================================================
                     T. castaneum  ======================================================================
                        D_montana  ======================================================================
B D                   D. sechellia  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                   D. melanogaster  --ataggg-------aaaacacacagacaat------tcgcacaacagtgaatcactttgcg-------a
                       D. simulans  --ataggg-------aaaaca----gacaat------tcacacaatagtgaatcactttgcg-------a
                         D. erecta  --gtaggg-------aaaa-acgcaaacagta-----gcagcgaaaagtgaatcactttgtg-------a
                         D. yakuba  --ataggg-------aaaaca--caaacaata-----gcagcgaaaagtgattcactttgcg-------a
                     D. ficusphila  --a-aagg-------aaaaca--caaacaata-----gcag---gcagtgaatcac-ttgtg-------a
                     D. eugracilis  --a-aagg-------aaaata--caaacaata-----gcag---gcagtgaatcactttgtg-------a
                      D. biarmipes  --aaggcggggaacaataact--caagcaata-----tctg---acggtgaatcac-ttgcg--------
                        D. suzukii  --agcaaggaaaacaataact--caaacaata-----tc---------tgaatcgctttgcg-------a
                     D. takahashii  ataacaaggaaagcaaaaaca--caaacaata-----actg---acagtgaatcactttgcg-------a
                        D. elegans  --aaaatg-------aaaaca--caaacaata-----gcag---gcagtgaatcactttgtg-------a
                       D. rhopaloa  --aacagg-------aaaaca--caaacaata-----gcag---gcagtgaatcactttgcg-------a
                         D_serrata  --gacagg-------caaaca--ataacaacagggg-gctg---agagtgaatcacttggcg-------a
                       D. kikkawai  --gagaga-------aaaaca--ataacagaaaggg-gctg---agggtgaatcacttggcg-------a
                      D. ananassae  --gtccga-------aaaacg--aaaacaaacacaacggtg---gctgtgaatcac-tcgcg--------
                    D. bipectinata  --gtccat-------aaattg----------------tttg---gccgaaaac-----------------
                       D_athabasca  --aagaat-------gactca--gaaatatc------ccac-----------ctaatctggg--------
                 D_pseudoobscura_1  --aagaat-------gactca--caaatatt------gcac-----------ttattctgtg-------t
                        D. miranda  --aagaat-------gactca--caaatatt------gcac-----------ttattccgtg-------t
                     D. persimilis  --aagaat-------gactca--caaatatt------gcac-----------ttattctgtg-------t
                  D. pseudoobscura  --aagagt-------gactca--caaatatt------gcac-----------ttattctgtg-------t
                      D_subobscura  --aagagt-------gactca--gaaatatt------gcac-----------tttatctgggaatatttg
                         D_obscura  --aagaat-------gactca--gaaatatc------gcac-----------ttaatctgga-atttttc
                     D. willistoni  ======================================================================
                      D. grimshawi  ======================================================================
                        D_arizonae  ======================================================================
                     D. mojavensis  ======================================================================
                        D. virilis  ======================================================================
                    D_novamexicana  ======================================================================
                     D. albomicans  ======================================================================
                          D_nasuta  ======================================================================
         Proctacanthus_coquilletti  ======================================================================
                 Bactrocera_tryoni  ======================================================================
                Belgica_antarctica  ======================================================================
             Culicoides_sonorensis  ======================================================================
                      A. mellifera  ======================================================================
             Lutzomyia_longipalpis  ======================================================================
                Chironomus_tentans  ======================================================================
                         A_farauti  ======================================================================
               Stomoxys_calcitrans  ======================================================================
                  Bactrocera_oleae  ======================================================================
                Ceratitis_capitata  ======================================================================
                   Lucilia_cuprina  ======================================================================
              Bactrocera_latifrons  ======================================================================
               Bactrocera_dorsalis  ======================================================================
             Zeugodacus_cucurbitae  ======================================================================
                       D_americana  ======================================================================
                      M. domestica  ======================================================================
                           D_hydei  ======================================================================
                Teleopsis_dalmanni  ======================================================================
                Zaprionus_indianus  ======================================================================
     Scaptodrosophila_lebanonensis  ======================================================================
                      T. castaneum  ======================================================================
                         D_montana  ======================================================================
                      D. sechellia  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                   D. melanogaster  ccaatg-----c------ttcggt-------taaaca-ggtacttctc-cgtatctctagct------aa
                       D. simulans  ccagtt-----c------tccggt-------tgaacatggaacttctc-cgtatctctggct------aa
                         D. erecta  ccagtt-----c------ttcagt-------tgagca-ggagctcgtc-cgtatctc-ggct------aa
                         D. yakuba  ctagtt-----c------ttcagt-------tgaacg-ggggcttttt-cgtatctctggct------aa
                     D. ficusphila  ccagttattcac------ttccac-------taaacagggaatttttc-cctctc---------------
                     D. eugracilis  ccagtt-----ctgtgtttccact-------taatctgggatttttcc-cgtatctctggaa------at
                      D. biarmipes  -gagta-----c------tcca--------------agggaactttcc-cgtatctcgggcg------gt
                        D. suzukii  cgagtt-----cttggcttccacttaca---tatatagggaattttcc-cgtatctcgggca------gt
                     D. takahashii  ccagtt-----c------ttcacttcccagttatattgggaattttcc-cgtatctcggtcg------aa
                        D. elegans  ccagtt-----c------ctccacttcctcataaacagggttttttcc-cgaattaa-------------
                       D. rhopaloa  ccattt-----c------taccacttccagttaaacatggatttttcc-cgcatata-------------
                         D_serrata  ccagtt-----c-----ctccact-------taaacggggaacttgtcgcctatctc-gccg------aa
                       D. kikkawai  ccagtt-----c-----ctccact-------tgagcagggaacttgtcgcctatctc-ggcg------aa
                      D. ananassae  -gaggt-----c--------------------tgata-----ttttcc-catatctt-------------
                    D. bipectinata  -gaaaa-----c--------------------aaaca---------------------------------
                       D_athabasca  -----------------------------------aa-----tcaggc-agaggcactggcactggcaca
                 D_pseudoobscura_1  ctttat-----c------tccatt--------taata-----tccggc-agaggcacaggaac-----cg
                        D. miranda  ctttat-----c------tccatt--------taata-----tccggc-agaggcacaggta------cg
                     D. persimilis  ctttat-----c------tccatt--------taata-----tccggc-agaggcacaggaac-----cg
                  D. pseudoobscura  ctttat-----c------tccatt--------taata-----tccggc-agaggcacaggaac-----cg
                      D_subobscura  ccatat-----c------tttatt--------caat-----------a-tcagacacaggca------ca
                         D_obscura  ccatat-----c------tccatt--------caata------------------tcaggca------ca
                     D. willistoni  ======================================================================
                      D. grimshawi  ======================================================================
                        D_arizonae  ======================================================================
                     D. mojavensis  ======================================================================
                        D. virilis  ======================================================================
                    D_novamexicana  ======================================================================
                     D. albomicans  ======================================================================
                          D_nasuta  ======================================================================
         Proctacanthus_coquilletti  ======================================================================
                 Bactrocera_tryoni  ======================================================================
                Belgica_antarctica  ======================================================================
             Culicoides_sonorensis  ======================================================================
                      A. mellifera  ======================================================================
             Lutzomyia_longipalpis  ======================================================================
                Chironomus_tentans  ======================================================================
                         A_farauti  ======================================================================
               Stomoxys_calcitrans  ======================================================================
                  Bactrocera_oleae  ======================================================================
                Ceratitis_capitata  ======================================================================
                   Lucilia_cuprina  ======================================================================
              Bactrocera_latifrons  ======================================================================
               Bactrocera_dorsalis  ======================================================================
             Zeugodacus_cucurbitae  ======================================================================
                       D_americana  ======================================================================
                      M. domestica  ======================================================================
                           D_hydei  ======================================================================
                Teleopsis_dalmanni  ======================================================================
                Zaprionus_indianus  ======================================================================
     Scaptodrosophila_lebanonensis  ======================================================================
                      T. castaneum  ======================================================================
                         D_montana  ======================================================================
                      D. sechellia  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                   D. melanogaster  cgcaa---aaacctttgactaatcgatggt
                       D. simulans  cgcaa---aaacctttgactaatcgatggt
                         D. erecta  cgcaa---gaatctttgactaatcgatggt
                         D. yakuba  tgcaa----aacttttgactaatcgatggt
                     D. ficusphila  --cga---aaacctttgactaatcgatggt
                     D. eugracilis  agcaa---aaacc-ttgactaatcgatggt
                      D. biarmipes  agc-a---gaaccattgactaatcgatggc
                        D. suzukii  ggcga---aaaccattgactaatcgatggt
                     D. takahashii  agcaa---aaacctttgactaatcgatggt
                        D. elegans  ----a---caacctttgactaatcgatagt
                       D. rhopaloa  ----a---ca----------aatcgatagt
                         D_serrata  agcga---aaagccttgactaatcgatggc
                       D. kikkawai  agcga---aaagccttgactaatcgatggc
                      D. ananassae  ---------gcccaccagttagtcaaaggg
                    D. bipectinata  -----------------------caatggt
                       D_athabasca  ggccaagtaaacccttgagtaatcgattag
                 D_pseudoobscura_1  ggcacactaaacccttgagtaatcgatgag
                        D. miranda  ggcacactaaacccttgagtaatcgatgag
                     D. persimilis  ggcacactaaacccttgagtaatcgatgag
                  D. pseudoobscura  ggcacactaaacccttgagtaatcgatgag
                      D_subobscura  ggcac---aaacccttgagtaatcgatgag
                         D_obscura  ggcacagcaaacccttgagtaatcgatgag
                     D. willistoni  ==============================
                      D. grimshawi  ==============================
                        D_arizonae  ==============================
                     D. mojavensis  ==============================
                        D. virilis  ==============================
                    D_novamexicana  ==============================
                     D. albomicans  ==============================
                          D_nasuta  ==============================
         Proctacanthus_coquilletti  ==============================
                 Bactrocera_tryoni  ==============================
                Belgica_antarctica  ==============================
             Culicoides_sonorensis  ==============================
                      A. mellifera  ==============================
             Lutzomyia_longipalpis  ==============================
                Chironomus_tentans  ==============================
                         A_farauti  ==============================
               Stomoxys_calcitrans  ==============================
                  Bactrocera_oleae  ==============================
                Ceratitis_capitata  ==============================
                   Lucilia_cuprina  ==============================
              Bactrocera_latifrons  ==============================
               Bactrocera_dorsalis  ==============================
             Zeugodacus_cucurbitae  ==============================
                       D_americana  ==============================
                      M. domestica  ==============================
                           D_hydei  ==============================
                Teleopsis_dalmanni  ==============================
                Zaprionus_indianus  ==============================
     Scaptodrosophila_lebanonensis  ==============================
                      T. castaneum  ==============================
                         D_montana  ==============================
                      D. sechellia  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 83 and 84 in window
                       D. elegans 129bp

Alignment block 84 of 1353 in window, 828178 - 828239, 62 bps 
B D                D. melanogaster  aaagtaaac------aaa---------a----acact---cg----ttatcacatgg-agattattatgg
  D                    D. simulans  aaagtaaac------aaa---------a----acact---cg----ttatcacatgg-agattattatgg
                         D. erecta  aaa-taaac------aaa---------a----gcact---cg----ttatcacatgg-aaattattatgg
                         D. yakuba  aaaataaac------aaa---------a----acact---cg----ttatcacatgg-aaattattatgg
                     D. ficusphila  aaa-taaac------aaa---------t----ac------------ttatttcataataaagtagtgagg
                     D. eugracilis  aaaataaac------aaa---------c-----caat---cg----ttatcacattg-aaattattatgg
                      D. biarmipes  -aaacaaac------a-----------a----gcact---tg----ttaccacctgg-cagttattgagg
                        D. suzukii  aaaataaac------aat---------a----acact---tg----ttatcaccttg-cacttat---gg
                     D. takahashii  aaaataaac------a-----------a----acact---cg----ttatcacattg-caattattatgg
                        D. elegans  aaagtaaac------aaa---------c----gaact---tg----ttatcaaatta-atattattatga
                       D. rhopaloa  aaaataaacagttcaaga---------g----gaact---taaattttcttggaata-atact-ttatag
                         D_serrata  aaaacaaac------aaacctgaaaaga----acactttgcg----ttatcacataa-gaattgctattg
                       D. kikkawai  aaaacaaac------aaacctaaagaga----gggcttcgtg----ttatcaaatca-gaattattatgg
                      D. ananassae  ------------------ggtgagtggagttcccact---tg----ttatcgcttct-aaa---------
                    D. bipectinata  ------------------gggctgtgaa----tcact---cg----ataaggcc----------------
                       D_athabasca  aaaacaaac-----aaaa---------c----aagcc---ag--------------c-aagctcttatct
                 D_pseudoobscura_1  aaaacacac------aaa---------c----aatcc---ag----ttagc-----c-aagctcttatct
                        D. miranda  aagacgtac------aaa---------c----aaacc---ag----ttagc-----c-aagctcttatct
B D                  D. persimilis  aaaacacac------aaa---------c----aatcc---ag----ttagc-----c-aagctcttatct
                  D. pseudoobscura  aaaacacac------aaa---------c----aatcc---ag----ttagc-----c-aagctcttatct
                      D_subobscura  aa-----ac------aaa---------c----aagcg---aa----gcaag-----c-aagctcttatct
                         D_obscura  aa-ataaac------aaa---------c----aagca---ag--------------c-aagctcttatct
                    D. willistoni  ======================================================================
                     D. grimshawi  ======================================================================
                       D_arizonae  ======================================================================
                    D. mojavensis  ======================================================================
                       D. virilis  ======================================================================
                   D_novamexicana  ======================================================================
                    D. albomicans  ======================================================================
                         D_nasuta  ======================================================================
        Proctacanthus_coquilletti  ======================================================================
                Bactrocera_tryoni  ======================================================================
               Belgica_antarctica  ======================================================================
            Culicoides_sonorensis  ======================================================================
                     A. mellifera  ======================================================================
            Lutzomyia_longipalpis  ======================================================================
               Chironomus_tentans  ======================================================================
                        A_farauti  ======================================================================
              Stomoxys_calcitrans  ======================================================================
                 Bactrocera_oleae  ======================================================================
               Ceratitis_capitata  ======================================================================
                  Lucilia_cuprina  ======================================================================
             Bactrocera_latifrons  ======================================================================
              Bactrocera_dorsalis  ======================================================================
            Zeugodacus_cucurbitae  ======================================================================
                      D_americana  ======================================================================
                     M. domestica  ======================================================================
                          D_hydei  ======================================================================
               Teleopsis_dalmanni  ======================================================================
               Zaprionus_indianus  ======================================================================
    Scaptodrosophila_lebanonensis  ======================================================================
                     T. castaneum  ======================================================================
                        D_montana  ======================================================================
B D                   D. sechellia  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                   D. melanogaster  cca-a-------------------------------aa----ttcgaac---aggaag
                       D. simulans  caa-c-------------------------------aa----ttcgaac---aggaag
                         D. erecta  caa-c-------------------------------ga----ttccaac-------ag
                         D. yakuba  cag-------------------------------------------------------
                     D. ficusphila  caa-c-------------------------------aa----tttcaac---aggaag
                     D. eugracilis  gta-a-------------------------------at----ttcagac---aggaac
                      D. biarmipes  cgg-t-------------------------------at----ttcggac---aggaag
                        D. suzukii  cga---------------------------------at----ttcagac---aggaag
                     D. takahashii  caaaa-------------------------------aa----taggaac---aggaag
                        D. elegans  cta-c-------------------------------at----tttaggc---aggaag
                       D. rhopaloa  tca-cttgttcccacatgaacaaagacattacccttat----ctcaggccaaagaaaa
                         D_serrata  tgc-c-------------------------------aatgggttcaggc---aggcag
                       D. kikkawai  tga-c-------------------------------aatggttttaggc---aggaag
                      D. ananassae  aag-a-------------------------------at----tccaaac---aggaag
                    D. bipectinata  -gg-a-------------------------------ac----tcttacc---agggaa
                       D_athabasca  a---------------------------------------------------------
                 D_pseudoobscura_1  a---------------------------------------------------------
                        D. miranda  a---------------------------------------------------------
                     D. persimilis  a---------------------------------------------------------
                  D. pseudoobscura  a---------------------------------------------------------
                      D_subobscura  a---------------------------------------------------------
                         D_obscura  a---------------------------------------------------------
                     D. willistoni  ==========================================================
                      D. grimshawi  ==========================================================
                        D_arizonae  ==========================================================
                     D. mojavensis  ==========================================================
                        D. virilis  ==========================================================
                    D_novamexicana  ==========================================================
                     D. albomicans  ==========================================================
                          D_nasuta  ==========================================================
         Proctacanthus_coquilletti  ==========================================================
                 Bactrocera_tryoni  ==========================================================
                Belgica_antarctica  ==========================================================
             Culicoides_sonorensis  ==========================================================
                      A. mellifera  ==========================================================
             Lutzomyia_longipalpis  ==========================================================
                Chironomus_tentans  ==========================================================
                         A_farauti  ==========================================================
               Stomoxys_calcitrans  ==========================================================
                  Bactrocera_oleae  ==========================================================
                Ceratitis_capitata  ==========================================================
                   Lucilia_cuprina  ==========================================================
              Bactrocera_latifrons  ==========================================================
               Bactrocera_dorsalis  ==========================================================
             Zeugodacus_cucurbitae  ==========================================================
                       D_americana  ==========================================================
                      M. domestica  ==========================================================
                           D_hydei  ==========================================================
                Teleopsis_dalmanni  ==========================================================
                Zaprionus_indianus  ==========================================================
     Scaptodrosophila_lebanonensis  ==========================================================
                      T. castaneum  ==========================================================
                         D_montana  ==========================================================
                      D. sechellia  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 84 and 85 in window
                     D. biarmipes 12bp
                       D. suzukii 268bp
                    D. takahashii 12bp
                       D. elegans 11bp
                      D. rhopaloa 11bp
                        D_serrata 2bp
                      D. kikkawai 2bp

Alignment block 85 of 1353 in window, 828240 - 828270, 31 bps 
B D                D. melanogaster  cacgattagaagttt-----ac------------------cgg----------caa------aaca----
  D                    D. simulans  ctcgattagaatttt-----ac------------------cgg----------aga------aaca----
                         D. erecta  ctcgactggaatttc-----aa------------------cgg----------aga---------a----
                         D. yakuba  --cgattggaagttt-----aa------------------cgg----------aga------agca----
                     D. ficusphila  ctaactaaatgcctt-----ac------------------tag---------------------------
                     D. eugracilis  cttcgtatacattta-----ac------------------cattttttttgttcga------agaa----
                      D. biarmipes  -----------tttt-----ac------------------tag----------gaat-------aa----
                     D. takahashii  -----------tttt-----ac------------------tag----------------------a----
                        D. elegans  -----------tttt-----aa------------------caa----------gaatttgttagaa----
                       D. rhopaloa  -----------atcg-----at------------------tgt----------aagttaatcaaaacaaa
                         D_serrata  ccagctaaatgtttt-----ag------------------cag----------aaa------agta----
                       D. kikkawai  caagccaaatgtttt-----ggcaagaatagtcacagtttcag----------gaa------agaa----
                      D. ananassae  ctccatc-------------at------------------cga----------taa--------------
                    D. bipectinata  ttttcccatatctttgactaat------------------cgg----------tga--------------
                       D_athabasca  ----------atgat-----ga------------------caa---------------------------
                 D_pseudoobscura_1  ----------atgat-----ga------------------caa---------------------------
                        D. miranda  ----------atgat-----ga------------------caa---------------------------
B D                  D. persimilis  ----------atgat-----ga------------------caa---------------------------
                  D. pseudoobscura  ----------atgat-----ga------------------caa---------------------------
                      D_subobscura  ----------atgat-----ga------------------caa---------------------------
                         D_obscura  ----------ataaa-----ga------------------caa---------------------------
                    D. willistoni  ======================================================================
                     D. grimshawi  ======================================================================
                       D_arizonae  ======================================================================
                    D. mojavensis  ======================================================================
                       D. virilis  ======================================================================
                   D_novamexicana  ======================================================================
                    D. albomicans  ======================================================================
                         D_nasuta  ======================================================================
        Proctacanthus_coquilletti  ======================================================================
                Bactrocera_tryoni  ======================================================================
               Belgica_antarctica  ======================================================================
            Culicoides_sonorensis  ======================================================================
                     A. mellifera  ======================================================================
            Lutzomyia_longipalpis  ======================================================================
               Chironomus_tentans  ======================================================================
                        A_farauti  ======================================================================
              Stomoxys_calcitrans  ======================================================================
                 Bactrocera_oleae  ======================================================================
               Ceratitis_capitata  ======================================================================
                  Lucilia_cuprina  ======================================================================
             Bactrocera_latifrons  ======================================================================
              Bactrocera_dorsalis  ======================================================================
            Zeugodacus_cucurbitae  ======================================================================
                      D_americana  ======================================================================
                     M. domestica  ======================================================================
                          D_hydei  ======================================================================
               Teleopsis_dalmanni  ======================================================================
               Zaprionus_indianus  ======================================================================
    Scaptodrosophila_lebanonensis  ======================================================================
                     T. castaneum  ======================================================================
                        D_montana  ======================================================================
B D                   D. sechellia  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       D. suzukii  ======================================================================

                   D. melanogaster  -aatt
                       D. simulans  -aatt
                         D. erecta  -gatt
                         D. yakuba  -aaca
                     D. ficusphila  -aatt
                     D. eugracilis  -attt
                      D. biarmipes  -gttc
                     D. takahashii  -attg
                        D. elegans  -gctt
                       D. rhopaloa  cgtta
                         D_serrata  -catt
                       D. kikkawai  -aact
                      D. ananassae  -----
                    D. bipectinata  -----
                       D_athabasca  -----
                 D_pseudoobscura_1  -----
                        D. miranda  -----
                     D. persimilis  -----
                  D. pseudoobscura  -----
                      D_subobscura  -----
                         D_obscura  -----
                     D. willistoni  =====
                      D. grimshawi  =====
                        D_arizonae  =====
                     D. mojavensis  =====
                        D. virilis  =====
                    D_novamexicana  =====
                     D. albomicans  =====
                          D_nasuta  =====
         Proctacanthus_coquilletti  =====
                 Bactrocera_tryoni  =====
                Belgica_antarctica  =====
             Culicoides_sonorensis  =====
                      A. mellifera  =====
             Lutzomyia_longipalpis  =====
                Chironomus_tentans  =====
                         A_farauti  =====
               Stomoxys_calcitrans  =====
                  Bactrocera_oleae  =====
                Ceratitis_capitata  =====
                   Lucilia_cuprina  =====
              Bactrocera_latifrons  =====
               Bactrocera_dorsalis  =====
             Zeugodacus_cucurbitae  =====
                       D_americana  =====
                      M. domestica  =====
                           D_hydei  =====
                Teleopsis_dalmanni  =====
                Zaprionus_indianus  =====
     Scaptodrosophila_lebanonensis  =====
                      T. castaneum  =====
                         D_montana  =====
                      D. sechellia  NNNNN
                        D. suzukii  =====

Inserts between block 85 and 86 in window
                      D. kikkawai 18bp

Alignment block 86 of 1353 in window, 828271 - 828283, 13 bps 
B D                D. melanogaster  tatgcatt-gcctg
  D                    D. simulans  t--------gcctg
                         D. erecta  t-------------
                         D. yakuba  t--------ttctg
                     D. ficusphila  t-------------
                     D. eugracilis  t--------agcgc
                      D. biarmipes  t--------agctt
                     D. takahashii  t--------gacac
                        D. elegans  t--------cgttt
                       D. rhopaloa  t--------caaaa
                       D. kikkawai  ----catgaagttt
                      D. ananassae  --agtccataactc
                    D. bipectinata  --tatgtagaactc
                    D. willistoni  ==============
                     D. grimshawi  ==============
                       D. miranda  --------------
                      D_athabasca  --------------
                 D. pseudoobscura  --------------
                       D_arizonae  ==============
                    D. mojavensis  ==============
                       D. virilis  ==============
                   D_novamexicana  ==============
                    D. albomicans  ==============
                         D_nasuta  ==============
        Proctacanthus_coquilletti  ==============
                Bactrocera_tryoni  ==============
               Belgica_antarctica  ==============
            Culicoides_sonorensis  ==============
                     A. mellifera  ==============
            Lutzomyia_longipalpis  ==============
               Chironomus_tentans  ==============
                        A_farauti  ==============
              Stomoxys_calcitrans  ==============
                 Bactrocera_oleae  ==============
               Ceratitis_capitata  ==============
                  Lucilia_cuprina  ==============
             Bactrocera_latifrons  ==============
              Bactrocera_dorsalis  ==============
            Zeugodacus_cucurbitae  ==============
                      D_americana  ==============
                     M. domestica  ==============
                D_pseudoobscura_1  --------------
                        D_obscura  --------------
                     D_subobscura  --------------
                          D_hydei  ==============
B D                  D. persimilis  --------------
               Teleopsis_dalmanni  ==============
               Zaprionus_indianus  ==============
    Scaptodrosophila_lebanonensis  ==============
                     T. castaneum  ==============
                        D_montana  ==============
B D                   D. sechellia  NNNNNNNNNNNNNN
                       D. suzukii  ==============

Inserts between block 86 and 87 in window
                     D. biarmipes 11bp
                    D. takahashii 360bp
                       D. elegans 10bp
                      D. rhopaloa 18bp
                      D. kikkawai 3bp
                   D. bipectinata 1bp

Alignment block 87 of 1353 in window, 828284 - 828352, 69 bps 
B D                D. melanogaster  catttctta--ttatatacgta---------------tgggtca-gt--------------------tgc
  D                    D. simulans  catttcttg--ttatatacgga---------------tgggtca-gt--------------------tgc
                         D. erecta  --------g--ttatatacggatttctaaggaaactctaggtca-gt--------------------tgc
                         D. yakuba  catttcttt--ttatacaccga--------ttggttctaggtca-gt--------------------tgc
                     D. ficusphila  ---------------atac------------------caggttg-at--------------------t--
                     D. eugracilis  aagaggaag--ttatattccta---------------ca-------t--------------------tcc
                      D. biarmipes  -ccttactt--ttgtagaagta-------------tctaggaca-ag--------------------ga-
                        D. elegans  ------tct--ttatatgggt--------------tccagg--a-at--------------------ta-
                       D. rhopaloa  gacttatta--ttatttaga-----------------cagg--a-ag--------------------ct-
                       D. kikkawai  -------------------------caattcaaactctttatta-at--------------------tgt
                      D. ananassae  ---------------------------------------------at--------------------aac
                    D. bipectinata  -------------------------------------cagttcttat--------------------cgc
                       D_athabasca  ----cattt--tgatgtgtcag---------------agaccca-gtttatagaaaaagatcttagattc
                 D_pseudoobscura_1  ----cattt--tgatgtgccag---------------ataccca-gt--------------------tcc
                        D. miranda  ----cattt--tgatgtgccag---------------ataccca-gt--------------------tcc
B D                  D. persimilis  ----cattt--tgatgtgccag---------------ataccca-gt--------------------tcc
                  D. pseudoobscura  ----cattt--tgatgtgccag---------------ataccca-gt--------------------tcc
                      D_subobscura  ----cattttatgatgtgccaa---------------agaccca-gt--------------------tct
                         D_obscura  ----ccttttgtgatgtgccaa---------------agaccca-gt--------------------tcc
                    D. willistoni  ======================================================================
                     D. grimshawi  ======================================================================
                       D_arizonae  ======================================================================
                    D. mojavensis  ======================================================================
                       D. virilis  ======================================================================
                   D_novamexicana  ======================================================================
                    D. albomicans  ======================================================================
                         D_nasuta  ======================================================================
        Proctacanthus_coquilletti  ======================================================================
                Bactrocera_tryoni  ======================================================================
               Belgica_antarctica  ======================================================================
            Culicoides_sonorensis  ======================================================================
                     A. mellifera  ======================================================================
            Lutzomyia_longipalpis  ======================================================================
               Chironomus_tentans  ======================================================================
                        A_farauti  ======================================================================